Mutants (Isolated)

tm677

Allele Nametm677
Sequence NameC01G8.5
CGC Nameerm-1
Worm BaseAllele Name tm677
CGC Name erm-1
Sequence C01G8.5
Phenotypelethal or sterile. Dr. V. Maricq: maternal effect lethal with defects in gonad and intestine development., Dr. V. Gobel: Dev. Cell 6, 865-873 (2004). Dr. M. Hengartner: defects in DTC migration but not in corpse removal in the L1 head and adult gonad.
Mutation site14065/14066-TT-15037/15038 (972 bp deletion + 2 bp insertion)
ChromosomeI
Putative gene structurecomplement(join(12105..12197, 12726..12892, 12970..13075, 13609..13956, 14039..14218, 14958..15140, 15189..15348, 15671..15825, 17500..17700, 17942..18025, 19001..19015))
Map position-0.16
BalancerhT2 [qIs48]
Map position of balancer
Sequence of primersIntFwd:CACATTCTGATCAGCGTCAT,IntRev:CAACTACACGTGAACAAGCT,ExtRev:GTGGGCAGATCATCGTGCAA,ExtFwd:CAACTCGTGTTGTGGCACAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Göbel V, Barrett PL, Hall DH, Fleming JT.
Lumen morphogenesis in C. elegans requires the membrane-cytoskeleton linker erm-1.
Dev. Cell 2004 6(6) 865-73 
[ PubMed ID = 15177034 ] [ RRC reference ]

Haag A, Gutierrez P, Bühler A, Walser M, Yang Q, Langouët M, Kradolfer D, Fröhli E, Herrmann CJ, Hajnal A, Escobar-Restrepo JM.
An in vivo EGF receptor localization screen in C. elegans Identifies the Ezrin homolog ERM-1 as a temporal regulator of signaling.
PLoS Genet. 2014 10(5) e1004341 
[ PubMed ID = 24785082 ] [ RRC reference ]

Bernadskaya YY, Patel FB, Hsu HT, Soto MC.
Arp2/3 promotes junction formation and maintenance in the Caenorhabditis elegans intestine by regulating membrane association of apical proteins.
Mol. Biol. Cell 2011 22(16) 2886-99 
[ PubMed ID = 21697505 ] [ RRC reference ]

Carberry K, Wiesenfahrt T, Geisler F, Stöcker S, Gerhardus H, Überbach D, Davis W, Jorgensen E, Leube RE, Bossinger O.
The novel intestinal filament organizer IFO-1 contributes to epithelial integrity in concert with ERM-1 and DLG-1.
Development 2012 139(10) 1851-62 
[ PubMed ID = 22510987 ] [ RRC reference ]

Teulière J, Gally C, Garriga G, Labouesse M, Georges-Labouesse E.
MIG-15 and ERM-1 promote growth cone directional migration in parallel to UNC-116 and WVE-1.
Development 2011 138(20) 4475-85 
[ PubMed ID = 21937599 ] [ RRC reference ]

Norris AD, Dyer JO, Lundquist EA.
The Arp2/3 complex, UNC-115/abLIM, and UNC-34/Enabled regulate axon guidance and growth cone filopodia formation in Caenorhabditis elegans.
Neural Dev 2009 4 38 
[ PubMed ID = 19799769 ] [ RRC reference ]

Yang Q, Roiz D, Mereu L, Daube M, Hajnal A.
The Invading Anchor Cell Induces Lateral Membrane Constriction during Vulval Lumen Morphogenesis in C. elegans.
Dev. Cell 2017 42(3) 271-285.e3 
[ PubMed ID = 28787593 ] [ RRC reference ]

Khan LA, Zhang H, Abraham N, Sun L, Fleming JT, Buechner M, Hall DH, Gobel V.
Intracellular lumen extension requires ERM-1-dependent apical membrane expansion and AQP-8-mediated flux.
Nat. Cell Biol. 2013 15(2) 143-56 
[ PubMed ID = 23334498 ] [ RRC reference ]