Mutants (Isolated)

tm677

Allele Nametm677
Sequence NameC01G8.5
CGC Nameerm-1
Worm BaseAllele Name tm677
CGC Name erm-1
Sequence C01G8.5
Phenotypelethal or sterile. Dr. V. Maricq: maternal effect lethal with defects in gonad and intestine development., Dr. V. Gobel: Dev. Cell 6, 865-873 (2004). Dr. M. Hengartner: defects in DTC migration but not in corpse removal in the L1 head and adult gonad.
Mutation site14065/14066-TT-15037/15038 (972 bp deletion + 2 bp insertion)
ChromosomeI
Putative gene structurecomplement(join(12105..12197, 12726..12892, 12970..13075, 13609..13956, 14039..14218, 14958..15140, 15189..15348, 15671..15825, 17500..17700, 17942..18025, 19001..19015))
Map position-0.16
BalancerhT2 [qIs48]
Map position of balancer
Sequence of primersIntFwd:CACATTCTGATCAGCGTCAT,IntRev:CAACTACACGTGAACAAGCT,ExtRev:GTGGGCAGATCATCGTGCAA,ExtFwd:CAACTCGTGTTGTGGCACAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Yang Q, Roiz D, Mereu L, Daube M, Hajnal A.
The Invading Anchor Cell Induces Lateral Membrane Constriction during Vulval Lumen Morphogenesis in C. elegans.
Dev. Cell 2017 42(3) 271-285.e3 
[ PubMed ID = 28787593 ] [ RRC reference ]

Teulière J, Gally C, Garriga G, Labouesse M, Georges-Labouesse E.
MIG-15 and ERM-1 promote growth cone directional migration in parallel to UNC-116 and WVE-1.
Development 2011 138(20) 4475-85 
[ PubMed ID = 21937599 ] [ RRC reference ]

Carberry K, Wiesenfahrt T, Geisler F, Stöcker S, Gerhardus H, Überbach D, Davis W, Jorgensen E, Leube RE, Bossinger O.
The novel intestinal filament organizer IFO-1 contributes to epithelial integrity in concert with ERM-1 and DLG-1.
Development 2012 139(10) 1851-62 
[ PubMed ID = 22510987 ] [ RRC reference ]

Bernadskaya YY, Patel FB, Hsu HT, Soto MC.
Arp2/3 promotes junction formation and maintenance in the Caenorhabditis elegans intestine by regulating membrane association of apical proteins.
Mol. Biol. Cell 2011 22(16) 2886-99 
[ PubMed ID = 21697505 ] [ RRC reference ]

Haag A, Gutierrez P, Bühler A, Walser M, Yang Q, Langouët M, Kradolfer D, Fröhli E, Herrmann CJ, Hajnal A, Escobar-Restrepo JM.
An in vivo EGF receptor localization screen in C. elegans Identifies the Ezrin homolog ERM-1 as a temporal regulator of signaling.
PLoS Genet. 2014 10(5) e1004341 
[ PubMed ID = 24785082 ] [ RRC reference ]

Khan LA, Zhang H, Abraham N, Sun L, Fleming JT, Buechner M, Hall DH, Gobel V.
Intracellular lumen extension requires ERM-1-dependent apical membrane expansion and AQP-8-mediated flux.
Nat. Cell Biol. 2013 15(2) 143-56 
[ PubMed ID = 23334498 ] [ RRC reference ]

Norris AD, Dyer JO, Lundquist EA.
The Arp2/3 complex, UNC-115/abLIM, and UNC-34/Enabled regulate axon guidance and growth cone filopodia formation in Caenorhabditis elegans.
Neural Dev 2009 4 38 
[ PubMed ID = 19799769 ] [ RRC reference ]

Göbel V, Barrett PL, Hall DH, Fleming JT.
Lumen morphogenesis in C. elegans requires the membrane-cytoskeleton linker erm-1.
Dev. Cell 2004 6(6) 865-73 
[ PubMed ID = 15177034 ] [ RRC reference ]