Mutants (Isolated)

tm6724

Allele Nametm6724
Sequence NameH19N07.2
CGC Namemath-33
Worm BaseAllele Name tm6724
CGC Name math-33
Sequence H19N07.2
Phenotypehomozygous viable.
Mutation site6706/6707-7352/7353 (646 bp deletion)
ChromosomeV
Putative gene structurejoin(4390..4601, 4656..4991, 5134..5600, 5767..6728, 6773..6890, 6935..7727, 7777..7891, 7945..8190, 8238..8310, 8420..8499)
Map position2.95
Balancer
Map position of balancer
Sequence of primersIntRev:TACCGGTCTTGTCATAAGTC,ExtFwd:GTACTTGGGATGGATAGCTG,ExtRev:CTTGTAGGCTCTGGGATCAT,IntFwd:AGGCATGTATTGACCATGCT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Senchuk MM, Dues DJ, Schaar CE, Johnson BK, Madaj ZB, Bowman MJ, Winn ME, Van Raamsdonk JM.
Activation of DAF-16/FOXO by reactive oxygen species contributes to longevity in long-lived mitochondrial mutants in Caenorhabditis elegans.
PLoS Genet. 2018 14(3) e1007268 
[ PubMed ID = 29522556 ] [ RRC reference ]