Mutants (Isolated)

tm669

Allele Nametm669
Allele TypeNormal
Sequence NameB0280.12
Gene Nameglr-2
Worm BaseAllele Name tm669
Gene Name glr-2
Sequence B0280.12
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. G. Jansen: WT chemotaxix to NaCl. Dr. K. Ashrafi: normal Nile Red staining. Dr. I. Mori: normal thermotaxix at 20C.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 37534/37535-AT-38583/38584 (1049 bp deletion + 2 bp insertion)
ChromosomeIII
Putative gene structurecomplement(join(36648..37029, 37095..37322, 37717..37811, 37859..37959, 38004..38101, 38148..38308, 38776..38970, 39035..39185, 39538..39689, 39733..40000, 40568..40723, 40767..40858, 40903..41031))
Map position-0.78
Balancer
Map position of balancer
Sequence of primersExtFwd:GCCTCTAGGCAGGTTATCAT,IntRev:CCGCAAAAAGTAACCTCTAC,IntFwd:CAGGCGTGGTGTTTCCTTTT,ExtRev:AAGCGCAATGAACCGCAAAA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Rawsthorne H, Calahorro F, Holden-Dye L, O' Connor V, Dillon J.
Investigating autism associated genes in C. elegans reveals candidates with a role in social behaviour.
PLoS One 2021 16(5) e0243121 
[ PubMed ID = 34043629 ] [ RRC reference ]

Hardaway JA, Sturgeon SM, Snarrenberg CL, Li Z, Xu XZ, Bermingham DP, Odiase P, Spencer WC, Miller DM 3rd, Carvelli L, Hardie SL, Blakely RD.
Glial Expression of the Caenorhabditis elegans Gene swip-10 Supports Glutamate Dependent Control of Extrasynaptic Dopamine Signaling.
J Neurosci 2015 35(25) 9409-23 
[ PubMed ID = 26109664 ] [ RRC reference ]

Hukema RK, Rademakers S, Jansen G.
Gustatory plasticity in C. elegans involves integration of negative cues and NaCl taste mediated by serotonin, dopamine, and glutamate.
Learn Mem 2008 15(11) 829-36 
[ PubMed ID = 18984564 ] [ RRC reference ]