Mutants (Isolated)

tm669

Allele Nametm669
Sequence NameB0280.12
CGC Nameglr-2
Worm BaseAllele Name tm669
CGC Name glr-2
Sequence B0280.12
Phenotypehomozygous viable. Dr. G. Jansen: WT chemotaxix to NaCl. Dr. K. Ashrafi: normal Nile Red staining. Dr. I. Mori: normal thermotaxix at 20C.
Mutation site37534/37535-AT-38583/38584 (1049 bp deletion + 2 bp insertion)
ChromosomeIII
Putative gene structurecomplement(join(36648..37029, 37095..37322, 37717..37811, 37859..37959, 38004..38101, 38148..38308, 38776..38970, 39035..39185, 39538..39689, 39733..40000, 40568..40723, 40767..40858, 40903..41031))
Map position-0.78
Balancer
Map position of balancer
Sequence of primersExtFwd:GCCTCTAGGCAGGTTATCAT,IntRev:CCGCAAAAAGTAACCTCTAC,IntFwd:CAGGCGTGGTGTTTCCTTTT,ExtRev:AAGCGCAATGAACCGCAAAA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Hardaway JA, Sturgeon SM, Snarrenberg CL, Li Z, Xu XZ, Bermingham DP, Odiase P, Spencer WC, Miller DM 3rd, Carvelli L, Hardie SL, Blakely RD.
Glial Expression of the Caenorhabditis elegans Gene swip-10 Supports Glutamate Dependent Control of Extrasynaptic Dopamine Signaling.
J. Neurosci. 2015 35(25) 9409-23 
[ PubMed ID = 26109664 ] [ RRC reference ]

Hukema RK, Rademakers S, Jansen G.
Gustatory plasticity in C. elegans involves integration of negative cues and NaCl taste mediated by serotonin, dopamine, and glutamate.
Learn. Mem. 2008 15(11) 829-36 
[ PubMed ID = 18984564 ] [ RRC reference ]