Mutants (Isolated)

tm6661

Allele Nametm6661
Sequence NameE02H9.8
CGC Namenhr-121
Worm BaseAllele Name tm6661
CGC Name nhr-121
Sequence E02H9.8
Phenotypehomozygous viable.
Mutation site16540/16541-GAAATTTCAAATT-18414/18415 (1874 bp deletion + 13 bp insertion)
ChromosomeIII
Putative gene structurecomplement(join(14023..14139, 14192..14349, 14403..14521, 14880..14978, 15447..15661, 16055..16187, 16959..17329, 17415..17465, 17715..17771, 17813..17867, 17952..18012, 18093..18157, 18225..18310))
Map position-13.39
Balancer
Map position of balancer
Sequence of primersIntRev:GGGTTATGCGTCTTTAGCCT,IntFwd:GTTTCGGGGGCTTAGCATTG,ExtFwd:AATAACCTCTCCTCCCGCAG,ExtRev:ATGGACATGGTAAGCTGAGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Sonoda S, Ohta A, Maruo A, Ujisawa T, Kuhara A.
Sperm Affects Head Sensory Neuron in Temperature Tolerance of Caenorhabditis elegans.
Cell Rep 2016 16(1) 56-65 
[ PubMed ID = 27320929 ] [ RRC reference ]