Mutants (Isolated)

tm666

Allele Nametm666
Sequence NameY39B6A.20
CGC Nameasp-1
Worm BaseAllele Name tm666
CGC Name asp-1
Sequence Y39B6A.20
Phenotypehomozygous viable. Dr. N. Tavernarakis: normal development, normal locomotion, slightly shorter, less progeny at 25C, starved appearance.
Mutation site92584/92585-TTTA-93065/93066 (481 bp deletion + 4 bp insertion)
ChromosomeV
Putative gene structurecomplement(91506..92696)
Map position18.5
Balancer
Map position of balancer
Sequence of primersExtRev:CGAATGACGTAAAAGGAGGA,IntRev:TAAAAGGAGGAGGGGGGTTG,ExtFwd:GTTTCCGATATCGTAGACGT,IntFwd:CAGTATTGACGGATGAAGGT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Kim DK, Lim HS, Kawasaki I, Shim YH, Vaikath NN, El-Agnaf OM, Lee HJ, Lee SJ.
Anti-aging treatments slow propagation of synucleinopathy by restoring lysosomal function.
Autophagy. 2016 12(10) 1849-1863. 
[ PubMed ID = -1 ] [ RRC reference ]

Zhang F, Peng D, Cheng C, Zhou W, Ju S, Wan D, Yu Z, Shi J, Deng Y, Wang F, Ye X, Hu Z, Lin J, Ruan L, Sun M.
Bacillus thuringiensis Crystal Protein Cry6Aa Triggers Caenorhabditis elegans Necrosis Pathway Mediated by Aspartic Protease (ASP-1).
PLoS Pathog. 2016 12(1) e1005389 
[ PubMed ID = 26795495 ] [ RRC reference ]