Mutants (Isolated)

tm6659

Allele Nametm6659
Sequence NameR13H8.1
CGC Namedaf-16
Worm BaseAllele Name tm6659
CGC Name daf-16
Sequence R13H8.1
Phenotypehomozygous viable
Mutation site3736/3737-4703/4704 (967 bp deletion)
ChromosomeI
Putative gene structureR13H8.1a=join(14814..15455, 16266..16427, 16590..16771, 16831..17050, 17300..17412, 18083..18356) daf-16f=join([H36N01] 3907..3930, 4169..4259, 4313..4463, [R13H8] 6960..7012, 7657..7802, 8516..8589, 16266..16427, 16590..16771, 16831..17050, 17300..17412, 18083..18356) daf-16b.=join(6409..6653, 6896..7012, 7663..7802, 8516..8589, 16266..16427, 16590..16771, 16831..17050, 17300..17412, 18083..18356)
Map position5.08
Balancer
Map position of balancer
Sequence of primersIntFwd:GGGTCGCTCAGAAGTTGATC,ExtFwd:GCATGGGGTCGCTCAGAAGT,IntRev:GACAATAGGCTTGTTGGCCT,ExtRev:CCGTGTGCTTAGTGGACCAA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Nagashima T, Iino Y, Tomioka M.
DAF-16/FOXO promotes taste avoidance learning independently of axonal insulin-like signaling.
PLoS Genet. 2019 15(7) e1008297 
[ PubMed ID = 31323047 ] [ RRC reference ]

Franz A, Pirson PA, Pilger D, Halder S, Achuthankutty D, Kashkar H, Ramadan K, Hoppe T.
Chromatin-associated degradation is defined by UBXN-3/FAF1 to safeguard DNA replication fork progression.
Nat Commun 2016 7 10612 
[ PubMed ID = 26842564 ] [ RRC reference ]

Chen AT, Guo C, Itani OA, Budaitis BG, Williams TW, Hopkins CE, McEachin RC, Pande M, Grant AR, Yoshina S, Mitani S, Hu PJ.
Longevity Genes Revealed by Integrative Analysis of Isoform-Specific daf-16/FoxO Mutants of Caenorhabditis elegans.
Genetics 2015 201(2) 613-29 
[ PubMed ID = 26219299 ] [ RRC reference ]