Mutants (Isolated)

tm6658

Allele Nametm6658
Sequence NameF48A11.5
CGC Nameubxn-3
Worm BaseAllele Name tm6658
CGC Name ubxn-3
Sequence F48A11.5
Phenotypehomozygous viable.
Mutation site25563/25564-26613/26614 (1050 bp deletion)
ChromosomeII
Putative gene structurecomplement(join(23366..23566, 23620..23829, 23879..24182, 24347..24564, 24616..24750, 25163..25551, 25911..25983, 26099..26195, 26352..26566, 26613..26669))
Map position-15.77
Balancer
Map position of balancer
Sequence of primersExtRev:CGCACGCCTCGTTTTCTCGT,IntFwd:AACGCTGAAATTGCACGGTC,ExtFwd:GACCTGACGCGCAACTTGAG,IntRev:GTCCGGGTCTCGACGAGAAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Franz A, Pirson PA, Pilger D, Halder S, Achuthankutty D, Kashkar H, Ramadan K, Hoppe T.
Chromatin-associated degradation is defined by UBXN-3/FAF1 to safeguard DNA replication fork progression.
Nat Commun 2016 7 10612 
[ PubMed ID = 26842564 ] [ RRC reference ]