Mutants (Isolated)

tm663

Allele Nametm663
Sequence NameC05A9.1
CGC Namepgp-5
Worm BaseAllele Name tm663
CGC Name pgp-5
Sequence C05A9.1
Phenotypehomozygous viable
Mutation site30908/30909-AATAA-31540/31541 (632 bp deletion + 5 bp insertion)
ChromosomeX
Putative gene structurecomplement(join(28410..28772, 28829..29032, 29079..29543, 29589..29717, 29768..29872, 29919..30281, 30327..30595, 30642..30741, 30790..30879, 30927..31538, 31781..31894, 31941..32112, 32154..32450, 32496..32629, 32676..32785, 32881..33205))
Map position2.57
Balancer
Map position of balancer
Sequence of primersExtRev:AGATTGGCGACTTGCTTGCT,ExtFwd:AACACTACCAAGGCGATCGT,IntRev:CTACGGAACTGTGTTTTCGT,IntFwd:TCCACTGCAGCAGTGACATT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Sundaram P, Han W, Cohen N, Echalier B, Albin J, Timmons L.
Caenorhabditis elegans ABCRNAi transporters interact genetically with rde-2 and mut-7.
Genetics 2008 178(2) 801-14 
[ PubMed ID = 18245353 ] [ RRC reference ]

C. elegans Deletion Mutant Consortium.
large-scale screening for targeted knockouts in the Caenorhabditis elegans genome.
G3 (Bethesda) 2012 2(11) 1415-25 
[ PubMed ID = 23173093 ] [ RRC reference ]