Home > Mutants (Isolated) > tm6600

Mutants (Isolated)

Allele Name		tm6600
Allele Type		Normal
Sequence Name		C05D9.2
Gene Name		lmp-2
Worm Base	Allele Name	tm6600
	Gene Name	lmp-2
	Sequence	C05D9.2
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		26427/26428-26786/26787 (359 bp deletion)
Chromosome		X
Putative gene structure		join(24745..24843, 25187..25273, 25814..25939, 26120..26415, 26591..26652, 26701..26801, 27083..27202)
Map position		-18.5
Balancer
Map position of balancer
Sequence of primers		IntFwd:GCCGTAATGTAGCCTACAAG,ExtFwd:AAGGTGCTACACGTAGGTAG,IntRev:GTAATCCACAACCAACCTTC,ExtRev:GTAACGTGTCAATAAGCAGG
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Li Y, Chen B, Zou W, Wang X, Wu Y, Zhao D, Sun Y, Liu Y, Chen L, Miao L, Yang C, Wang X. The lysosomal membrane protein SCAV-3 maintains lysosome integrity and adult longevity. J Cell Biol 2016 215(2) 167-185  [ PubMed ID = 27810910 ] [ RRC reference ]