Mutants (Isolated)

tm6600

Allele Nametm6600
Sequence NameC05D9.2
CGC Namelmp-2
Worm BaseAllele Name tm6600
CGC Name lmp-2
Sequence C05D9.2
Phenotypehomozygous viable.
Mutation site26427/26428-26786/26787 (359 bp deletion)
ChromosomeX
Putative gene structurejoin(24745..24843, 25187..25273, 25814..25939, 26120..26415, 26591..26652, 26701..26801, 27083..27202)
Map position-18.5
Balancer
Map position of balancer
Sequence of primersIntFwd:GCCGTAATGTAGCCTACAAG,ExtFwd:AAGGTGCTACACGTAGGTAG,IntRev:GTAATCCACAACCAACCTTC,ExtRev:GTAACGTGTCAATAAGCAGG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Li Y, Chen B, Zou W, Wang X, Wu Y, Zhao D, Sun Y, Liu Y, Chen L, Miao L, Yang C, Wang X.
The lysosomal membrane protein SCAV-3 maintains lysosome integrity and adult longevity.
J Cell Biol 2016 215(2) 167-185 
[ PubMed ID = 27810910 ] [ RRC reference ]