Mutants (Isolated)

tm659

Allele Nametm659
Sequence NameC41C4.8
CGC Namecdc-48.2
Worm BaseAllele Name tm659
CGC Name cdc-48.2
Sequence C41C4.8
Phenotypehomozygous viable. Dr. T. Schedl: no germline phenotype, although smaller brood size (180-200/mom). Dr. T. Ogura: BBRC 345, 746-753 (2006). Genes to Cells: 12, 1063 (2007). Dr. A. Colavita: no VC neuron axon branching defects. Dr. T. Hoppe: J. Struct. Biol. 156, 41 (2006), Nat. Cell Biol. 9, 379 (2007).
Mutation site[F10B5] 879/880-[F10B5] 1518/1519 (639 bp deletion)
ChromosomeII
Putative gene structurejoin(39039..39110,39159..39484,39531..39750, Z48334.1:100..855, Z48334.1:908..1626, Z48334.1:1686..2025)
Map position0.71
Balancer
Map position of balancer
Sequence of primersExtFwd:TTTAACCATGGCCTCAGTTC,IntFwd:CCGACTCAGAGAGACGAGAA,ExtRev:TTCAAATCGAGATCGGCGGA,IntRev:GTTTTGCGGAGTGAGGCCTT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Zou CG, Ma YC, Dai LL, Zhang KQ.
Autophagy protects C. elegans against necrosis during Pseudomonas aeruginosa infection.
Proc Natl Acad Sci U S A 2014 111(34) 12480-5 
[ PubMed ID = 25114220 ] [ RRC reference ]

Marza E, Taouji S, Barroso K, Raymond AA, Guignard L, Bonneu M, Pallares-Lupon N, Dupuy JW, Fernandez-Zapico ME, Rosenbaum J, Palladino F, Dupuy D, Chevet E.
Genome-wide screen identifies a novel p97/CDC-48-dependent pathway regulating ER-stress-induced gene transcription.
EMBO Rep 2015 16(3) 332-40 
[ PubMed ID = 25652260 ] [ RRC reference ]

Franz A, Pirson PA, Pilger D, Halder S, Achuthankutty D, Kashkar H, Ramadan K, Hoppe T.
Chromatin-associated degradation is defined by UBXN-3/FAF1 to safeguard DNA replication fork progression.
Nat Commun 2016 7 10612 
[ PubMed ID = 26842564 ] [ RRC reference ]

Liu G, Rogers J, Murphy CT, Rongo C.
EGF signalling activates the ubiquitin proteasome system to modulate C. elegans lifespan.
EMBO J 2011 30(15) 2990-3003 
[ PubMed ID = 21673654 ] [ RRC reference ]

Sasagawa Y, Yamanaka K, Saito-Sasagawa Y, Ogura T.
Caenorhabditis elegans UBX cofactors for CDC-48/p97 control spermatogenesis.
Genes Cells 2010 15(12) 1201-15 
[ PubMed ID = 20977550 ] [ RRC reference ]

Kuhlbrodt K, Janiesch PC, Kevei É, Segref A, Barikbin R, Hoppe T.
The Machado-Joseph disease deubiquitylase ATX-3 couples longevity and proteostasis.
Nat Cell Biol 2011 13(3) 273-81 
[ PubMed ID = 21317884 ] [ RRC reference ]

Martínez-Velázquez LA, Ringstad N.
Antagonistic regulation of trafficking to Caenorhabditis elegans sensory cilia by a Retinal Degeneration 3 homolog and retromer.
Proc Natl Acad Sci U S A 2018 115(3) E438-E447 
[ PubMed ID = 29282322 ] [ RRC reference ]

Yamauchi S, Yamanaka K, Ogura T.
Comparative analysis of expression of two p97 homologues in Caenorhabditis elegans.
Biochem Biophys Res Commun 2006 345(2) 746-53 
[ PubMed ID = 16701565 ] [ RRC reference ]

Mouysset J, Kähler C, Hoppe T.
A conserved role of Caenorhabditis elegans CDC-48 in ER-associated protein degradation.
J Struct Biol 2006 156(1) 41-9 
[ PubMed ID = 16647269 ] [ RRC reference ]

Jablonski AM, Lamitina T, Liachko NF, Sabatella M, Lu J, Zhang L, Ostrow LW, Gupta P, Wu CY, Doshi S, Mojsilovic-Petrovic J, Lans H, Wang J, Kraemer B, Kalb RG.
Loss of RAD-23 Protects Against Models of Motor Neuron Disease by Enhancing Mutant Protein Clearance.
J Neurosci 2015 35(42) 14286-306 
[ PubMed ID = 26490867 ] [ RRC reference ]

Sasagawa Y, Otani M, Higashitani N, Higashitani A, Sato K, Ogura T, Yamanaka K.
Caenorhabditis elegans p97 controls germline-specific sex determination by controlling the TRA-1 level in a CUL-2-dependent manner.
J Cell Sci 2009 122(Pt 20) 3663-72 
[ PubMed ID = 19773360 ] [ RRC reference ]

Rodrigues AJ, Neves-Carvalho A, Ferro A, Rokka A, Corthals G, Logarinho E, Maciel P.
ATX-3, CDC-48 and UBXN-5: a new trimolecular complex in Caenorhabditis elegans.
Biochem Biophys Res Commun 2009 386(4) 575-81 
[ PubMed ID = 19545544 ] [ RRC reference ]

Arur S, Ohmachi M, Nayak S, Hayes M, Miranda A, Hay A, Golden A, Schedl T.
Multiple ERK substrates execute single biological processes in Caenorhabditis elegans germ-line development.
Proc Natl Acad Sci U S A 2009 106(12) 4776-81 
[ PubMed ID = 19264959 ] [ RRC reference ]

Janiesch PC, Kim J, Mouysset J, Barikbin R, Lochmüller H, Cassata G, Krause S, Hoppe T.
The ubiquitin-selective chaperone CDC-48/p97 links myosin assembly to human myopathy.
Nat Cell Biol 2007 9(4) 379-90 
[ PubMed ID = 17369820 ] [ RRC reference ]

Sasagawa Y, Yamanaka K, Ogura T.
ER E3 ubiquitin ligase HRD-1 and its specific partner chaperone BiP play important roles in ERAD and developmental growth in Caenorhabditis elegans.
Genes Cells 2007 12(9) 1063-73 
[ PubMed ID = 17825049 ] [ RRC reference ]