Mutants (Isolated)

tm658

Allele Nametm658
Sequence NameF56A3.5
CGC Namebro-1
Worm BaseAllele Name tm658
CGC Name bro-1
Sequence F56A3.5
Phenotypehomozygous viable. Dr. J. Lee: intron deletion. Dr. M. Herman: Dyf(+).
Mutation site16853/16854-AGGAGAGAG-17313/17314 (460 bp deletion + 9 bp insertion)
ChromosomeI
Putative gene structurejoin(15956..16120, 16553..16618, 17360..17587)
Map position-0.3
Balancer
Map position of balancer
Sequence of primersExtRev:CCGTTCAATTCACGAAGCAT,IntRev:GGACCTGCGAGTTGTAACAA,IntFwd:CCGACAACATTTGTCGGTGA,ExtFwd:TTCTTGTGACTCCGCCTCCT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Ji YJ, Singaravelu G, Ahnn J.
RNT-1 regulation in C. elegans.
J. Cell. Biochem. 2005 96(1) 8-15 
[ PubMed ID = 15988754 ] [ RRC reference ]

Kagoshima H, Nimmo R, Saad N, Tanaka J, Miwa Y, Mitani S, Kohara Y, Woollard A.
The C. elegans CBFbeta homologue BRO-1 interacts with the Runx factor, RNT-1, to promote stem cell proliferation and self-renewal.
Development 2007 134(21) 3905-15 
[ PubMed ID = 17933794 ] [ RRC reference ]