Mutants (Isolated)

tm656

Allele Nametm656
Sequence NameF39D8.2
CGC Namepsa-3
Worm BaseAllele Name tm656
CGC Name psa-3
Sequence F39D8.2
Phenotypehomozygous viable. Dr. H. Sawa: 0% Psa (n=102).
Mutation site5578/5579-6504/6505 (926 bp deletion)
ChromosomeX
Putative gene structurejoin(6816..6905, 15245..15401, 16379..16719)
Map position22.59
Balancer
Map position of balancer
Sequence of primersIntFwd:ATTGCAAGTGTCAGGCGTAC,ExtRev:CATACCCGCTTAATGTCATC,ExtFwd:CTTTGTCGGCATAATCCGTT,IntRev:CTGTTTCGAACGCCTTCCTA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Arata Y, Kouike H, Zhang Y, Herman MA, Okano H, Sawa H.
Wnt signaling and a Hox protein cooperatively regulate psa-3/Meis to determine daughter cell fate after asymmetric cell division in C. elegans.
Dev. Cell 2006 11(1) 105-15 
[ PubMed ID = 16824957 ] [ RRC reference ]