Allele Name | tm655 |
Sequence Name | F48E8.5 |
CGC Name | paa-1 |
Worm Base | Allele Name |
tm655
|
CGC Name |
paa-1
|
Sequence |
F48E8.5
|
Phenotype | lethal or sterile. Dr. M. Jantsch: no meiotic phenotype. |
Mutation site | 7768/7769-9196/9197 (1428 bp deletion) |
Chromosome | III |
Putative gene structure | join(6868..6983, 7253..7347, 7498..8017, 8069..8928, 8976..9193, 9247..9326, 9371..9462, 9517..9530) |
Map position | -1.72 |
Balancer | qC1 [qIs26] |
Map position of balancer | |
Sequence of primers | IntRev:CTTCAAACTCTTTGCGGCGT,IntFwd:GGATTGTGCTATTGCAGTGA,ExtFwd:ATGAGAGCTCTACGACCGCA,ExtRev:TTCCTGTCACCTTGGGGTCA |
Distributed lab | |
Depositor | Dr. S. Mitani |
References |
Please submit your publication
Ogura K, Okada T, Mitani S, Gengyo-Ando K, Baillie DL, Kohara Y, Goshima Y. Protein phosphatase 2A cooperates with the autophagy-related kinase UNC-51 to regulate axon guidance in Caenorhabditis elegans. Development 2010 137(10) 1657-67
[ PubMed ID = 20392746 ]
[ RRC reference ]
|
Song MH, Liu Y, Anderson DE, Jahng WJ, O'Connell KF. Protein phosphatase 2A-SUR-6/B55 regulates centriole duplication in C. elegans by controlling the levels of centriole assembly factors. Dev Cell 2011 20(4) 563-71
[ PubMed ID = 21497766 ]
[ RRC reference ]
|
|