Mutants (Isolated)

tm6514

Allele Nametm6514
Sequence NameT26F2.3
CGC NameT26F2.3
Worm BaseAllele Name tm6514
CGC Name T26F2.3
Sequence T26F2.3
Phenotypehomozygous viable.
Mutation site11536/11537-TGTCGCATTTGACACCTTTTCGTTTGGATTATGGTGGTTTCCCAAGTCATTAAGAGTCATGTACTTCTCAAAGTTATACCCTGCTCCGCAATTATCTATATAGGACTTTCCGAGCTTGTGGAGAAATATTACTCCATTCTTGCGGAGAACTACAATTTCAAACGGTGTTTGGTTATAATTTGACGCTG-12204/12205 (668 bp deletion + 188 bp insertion)
ChromosomeV
Putative gene structurecomplement(join(10974..11201, 11249..11397, 11446..11776, 11824..12010, 12060..12115))
Map position5.87
Balancer
Map position of balancer
Sequence of primersIntRev:ATCCACCGAAGCAGGAGTTA,ExtRev:TCGCTACCAGTTCATCCGAT,IntFwd:GCTAACTCGCTGGGTCTGGA,ExtFwd:GCGCATATATGTACATCCTG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Shen Y, Zhang J, Calarco JA, Zhang Y.
EOL-1, the homolog of the mammalian Dom3Z, regulates olfactory learning in C. elegans.
J. Neurosci. 2014 34(40) 13364-70 
[ PubMed ID = 25274815 ] [ RRC reference ]