Home > Mutants (Isolated) > tm6506

Mutants (Isolated)

Allele Name		tm6506
Sequence Name		F58G6.9
CGC Name		F58G6.9
Worm Base	Allele Name	tm6506
	CGC Name	F58G6.9
	Sequence	F58G6.9
Phenotype		homozygous viable.
Mutation site		11871/11872-12335/12336 (464 bp deletion)
Chromosome		IV
Putative gene structure		join(11936..12068, 12113..12278, 12411..12501, 12546..12626)
Map position		4.35
Balancer
Map position of balancer
Sequence of primers		ExtFwd:CGATAAGAAGGCATGATGCA,IntFwd:CCGTTATCAGTGAAAGTCGA,IntRev:GCATTGTGGGATCGAACCGA,ExtRev:TAGCTCAGAAGTGACGCCTG
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Yuan S, Sharma AK, Richart A, Lee J, Kim BE. CHCA-1 is a copper-regulated CTR1 homolog required for normal development, copper accumulation, and copper-sensing behavior in Caenorhabditis elegans. J Biol Chem 2018 293(28) 10911-10925  [ PubMed ID = 29784876 ] [ RRC reference ] Yuan S, Sharma AK, Richart A, Lee J, Kim BE. CHCA-1 is a copper-regulated CTR1 homolog required for normal development, copper accumulation, and copper-sensing behavior in Caenorhabditis elegans. J Biol Chem 2018 293(28) 10911-10925  [ PubMed ID = 29784876 ] [ RRC reference ]