Mutants (Isolated)

tm649

Allele Nametm649
Sequence NameZK1053.5
CGC Namescrm-2
Worm BaseAllele Name tm649
CGC Name scrm-2
Sequence ZK1053.5
Phenotypehomozygous viable
Mutation site8590/8591-9006/9007 (416 bp deletion)
ChromosomeI
Putative gene structurejoin(7667..8029, 8194..8436, 8480..8582, 8627..8685, 8741..8770)
Map position17.25
Balancer
Map position of balancer
Sequence of primersIntFwd:TCGCTGGTCCCACTTTCTGA,IntRev:GCATGTCGGTGGTAACGATA,ExtRev:ATGTGCATGGCAGTAGAGCA,ExtFwd:ACTTTCCGAACACATTCGCT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Johnson NM, Lemmens BB, Tijsterman M.
A role for the malignant brain tumour (MBT) domain protein LIN-61 in DNA double-strand break repair by homologous recombination.
PLoS Genet 2013 9(3) e1003339 
[ PubMed ID = 23505385 ] [ RRC reference ]