Mutants (Isolated)

tm648

Allele Nametm648
Sequence NameT23F11.3
CGC Namecdka-1
Worm BaseAllele Name tm648
CGC Name cdka-1
Sequence T23F11.3
Phenotypehomozygous viable. Dr. J. Kaplan: Mol. Biol. Cell 18, 3883 (2007).
Mutation site14583/14584-15416/15417 (833 bp deletion)
ChromosomeIII
Putative gene structurejoin(14126..14372, 14796..14916, 14964..15125, 15402..15480, 15530..15761, 15875..15999, 16838..16972)
Map position-2.95
Balancer
Map position of balancer
Sequence of primersIntRev:ATCCACGCGTGTAACTCTTC,ExtRev:ACGAGTAGGAAACGTACAAG,ExtFwd:CATCTCTTTTCACCCGGAGA,IntFwd:ATGGAGGACCCACTTTTGCA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Juo P, Harbaugh T, Garriga G, Kaplan JM.
CDK-5 regulates the abundance of GLR-1 glutamate receptors in the ventral cord of Caenorhabditis elegans.
Mol. Biol. Cell 2007 18(10) 3883-93 
[ PubMed ID = 17671168 ] [ RRC reference ]

Ou CY, Poon VY, Maeder CI, Watanabe S, Lehrman EK, Fu AK, Park M, Fu WY, Jorgensen EM, Ip NY, Shen K.
Two cyclin-dependent kinase pathways are essential for polarized trafficking of presynaptic components.
Cell 2010 141(5) 846-58 
[ PubMed ID = 20510931 ] [ RRC reference ]

Nix P, Hammarlund M, Hauth L, Lachnit M, Jorgensen EM, Bastiani M.
Axon regeneration genes identified by RNAi screening in C. elegans.
J. Neurosci. 2014 34(2) 629-45 
[ PubMed ID = 24403161 ] [ RRC reference ]