Allele Name | tm648 |
Sequence Name | T23F11.3 |
CGC Name | cdka-1 |
Worm Base | Allele Name |
tm648
|
CGC Name |
cdka-1
|
Sequence |
T23F11.3
|
Phenotype | homozygous viable. Dr. J. Kaplan: Mol. Biol. Cell 18, 3883 (2007). |
Mutation site | 14583/14584-15416/15417 (833 bp deletion) |
Chromosome | III |
Putative gene structure | join(14126..14372, 14796..14916, 14964..15125, 15402..15480, 15530..15761, 15875..15999, 16838..16972) |
Map position | -2.95 |
Balancer | |
Map position of balancer | |
Sequence of primers | IntRev:ATCCACGCGTGTAACTCTTC,ExtRev:ACGAGTAGGAAACGTACAAG,ExtFwd:CATCTCTTTTCACCCGGAGA,IntFwd:ATGGAGGACCCACTTTTGCA |
Distributed lab | |
Depositor | Dr. S. Mitani/NBRP |
References |
Please submit your publication
Juo P, Harbaugh T, Garriga G, Kaplan JM. CDK-5 regulates the abundance of GLR-1 glutamate receptors in the ventral cord of Caenorhabditis elegans. Mol. Biol. Cell 2007 18(10) 3883-93
[ PubMed ID = 17671168 ]
[ RRC reference ]
|
Ou CY, Poon VY, Maeder CI, Watanabe S, Lehrman EK, Fu AK, Park M, Fu WY, Jorgensen EM, Ip NY, Shen K. Two cyclin-dependent kinase pathways are essential for polarized trafficking of presynaptic components. Cell 2010 141(5) 846-58
[ PubMed ID = 20510931 ]
[ RRC reference ]
|
Nix P, Hammarlund M, Hauth L, Lachnit M, Jorgensen EM, Bastiani M. Axon regeneration genes identified by RNAi screening in C. elegans. J. Neurosci. 2014 34(2) 629-45
[ PubMed ID = 24403161 ]
[ RRC reference ]
|
|