Mutants (Isolated)

tm6474

Allele Nametm6474
Sequence NameZK593.6
CGC Namelgg-2
Worm BaseAllele Name tm6474
CGC Name lgg-2
Sequence ZK593.6
Phenotypehomozygous viable
Mutation site25156/25157-25503/25504 (347 bp deletion)
ChromosomeIV
Putative gene structurecomplement(join(24970..25123, 25175..25343, 25962..26031))
Map position4.75
Balancer
Map position of balancer
Sequence of primersIntRev:CCCGTCCATTGTAAAAGGTC,ExtRev:AGAAGGCCATTCCGTAAGTT,IntFwd:GCGAGGGGCGAAATTAGCAA,ExtFwd:CGGGCTGGAAAATGCGGAGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Djeddi A, Al Rawi S, Deuve JL, Perrois C, Liu YY, Russeau M, Sachse M, Galy V.
Sperm-inherited organelle clearance in C. elegans relies on LC3-dependent autophagosome targeting to the pericentrosomal area.
Development 2015 142(9) 1705-16 
[ PubMed ID = 25922527 ] [ RRC reference ]

Wu F, Watanabe Y, Guo XY, Qi X, Wang P, Zhao HY, Wang Z, Fujioka Y, Zhang H, Ren JQ, Fang TC, Shen YX, Feng W, Hu JJ, Noda NN, Zhang H.
Structural Basis of the Differential Function of the Two C. elegans Atg8 Homologs, LGG-1 and LGG-2, in Autophagy.
Mol. Cell 2015 60(6) 914-29 
[ PubMed ID = 26687600 ] [ RRC reference ]