Mutants (Isolated)

tm6453

Allele Nametm6453
Sequence NameC27F2.1
CGC NameC27F2.1
Worm BaseAllele Name tm6453
CGC Name C27F2.1
Sequence C27F2.1
Phenotypehomozygous viable.
Mutation site29948/29949-T-30623/30624 (675 bp deletion + 1 bp insertion)
ChromosomeIII
Putative gene structurejoin(29888..29922, 29964..30219, 30273..30395, 30696..30792, 30977..31248, 31292..31412, 31760..31901, 32040..32112, 32166..32238, 32312..32420, 32771..32899, 33208..33353, 33400..33458, 33536..33651, 33695..33791, 33842..34015)
Map position-2.27
Balancer
Map position of balancer
Sequence of primersIntRev:TGCACTCAAATGCCGGGCTT,IntFwd:TACCCTCCCCGCAAAACCTC,ExtRev:GTAGCTCTCTGTCACCGACT,ExtFwd:CCGATTTTACCCTCCCCGCA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Fuxman Bass JI, Pons C, Kozlowski L, Reece-Hoyes JS, Shrestha S, Holdorf AD, Mori A, Myers CL, Walhout AJ.
A gene-centered C. elegans protein-DNA interaction network provides a framework for functional predictions.
Mol Syst Biol 2016 12(10) 884 
[ PubMed ID = 27777270 ] [ RRC reference ]