Mutants (Isolated)

tm642

Allele Nametm642
Sequence NameM60.5
CGC Namekqt-2
Worm BaseAllele Name tm642
CGC Name kqt-2
Sequence M60.5
Phenotypehomozygous viable
Mutation site13097/13098-13968/13969 (871 bp deletion)
ChromosomeX
Putative gene structurecomplement(join(11804..11972, 12026..12291, 12459..12656, 12804..12954, 13004..13232, 13519..13689, 13735..13868, 13933..14006, 14084..14214, 14260..14436, 14483..14562, 14611..14825))
Map position-0.27
Balancer
Map position of balancer
Sequence of primersExtFwd:AACAACTGCTAGCGTGTCTG,IntRev:CCAACACCCCAATGTTTGTT,IntFwd:TGGCAGACTGGAACGTCGAT,ExtRev:ACGTTGCGTTATCAGTTGAC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Nehrke K, Denton J, Mowrey W.
Intestinal Ca2+ wave dynamics in freely moving C. elegans coordinate execution of a rhythmic motor program.
Am. J. Physiol., Cell Physiol. 2008 294(1) C333-44 
[ PubMed ID = 17942636 ] [ RRC reference ]