Mutants (Isolated)

tm6369

Allele Nametm6369
BalanceNot Required
OutCrossNot Accepted
Sequence NameF52B11.1
Gene Namecfp-1
Worm BaseAllele Name tm6369 (x1)
Gene Name cfp-1
Sequence F52B11.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 9787/9788-10041/10042 (254 bp deletion)
ChromosomeIV
Putative gene structurejoin(8124..8366, 9296..9606, 9832..10037, 10686..10891)
Map position11.41
BalancernT1
Map position of balancer
Sequence of primersExtFwd:AGGAGTGCACGAGCCACGTA,IntRev:ATGCAGTGCCTGGTCTCGAC,IntFwd:GTTAGAGCTTTACACGGTCA,ExtRev:ACACGGGGCAGTTTGTGCGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Robert VJ, Caron M, Gely L, Adrait A, Pakulska V, Couté Y, Chevalier M, Riedel CG, Bedet C, Palladino F.
SIN-3 acts in distinct complexes to regulate the germline transcriptional program in Caenorhabditis elegans.
Development 2023 150(21)  
[ PubMed ID = 37818613 ] [ RRC reference ]

Caron M, Gely L, Garvis S, Adrait A, Couté Y, Palladino F, Fabrizio P.
Loss of SET1/COMPASS methyltransferase activity reduces lifespan and fertility in Caenorhabditis elegans.
Life Sci Alliance 2022 5(3)  
[ PubMed ID = 34893559 ] [ RRC reference ]

Herbette M, Robert V, Bailly A, Gely L, Feil R, Llères D, Palladino F.
A Role for Caenorhabditis elegans COMPASS in Germline Chromatin Organization.
Cells 2020 9(9)  
[ PubMed ID = 32911802 ] [ RRC reference ]

Beurton F, Stempor P, Caron M, Appert A, Dong Y, Chen RA, Cluet D, Couté Y, Herbette M, Huang N, Polveche H, Spichty M, Bedet C, Ahringer J, Palladino F.
Physical and functional interaction between SET1/COMPASS complex component CFP-1 and a Sin3S HDAC complex in C. elegans.
Nucleic Acids Res 2019 47(21) 11164-11180 
[ PubMed ID = 31602465 ] [ RRC reference ]

Pokhrel B, Chen Y, Biro JJ.
CFP-1 interacts with HDAC1/2 complexes in C. elegans development.
FEBS J 2019 286(13) 2490-2504 
[ PubMed ID = 30941832 ] [ RRC reference ]