Mutants (Isolated)

tm6369

Allele Nametm6369
Sequence NameF52B11.1
CGC Namecfp-1
Worm BaseAllele Name tm6369
CGC Name cfp-1
Sequence F52B11.1
Phenotypehomozygous viable.
Mutation site9787/9788-10041/10042 (254 bp deletion)
ChromosomeIV
Putative gene structurejoin(8124..8366, 9296..9606, 9832..10037, 10686..10891)
Map position11.41
Balancer
Map position of balancer
Sequence of primersExtFwd:AGGAGTGCACGAGCCACGTA,IntRev:ATGCAGTGCCTGGTCTCGAC,IntFwd:GTTAGAGCTTTACACGGTCA,ExtRev:ACACGGGGCAGTTTGTGCGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Herbette M, Robert V, Bailly A, Gely L, Feil R, Llères D, Palladino F.
A Role for Caenorhabditis elegans COMPASS in Germline Chromatin Organization.
Cells 2020 9(9)  
[ PubMed ID = 32911802 ] [ RRC reference ]

Pokhrel B, Chen Y, Biro JJ.
CFP-1 interacts with HDAC1/2 complexes in C. elegans development.
FEBS J 2019 286(13) 2490-2504 
[ PubMed ID = 30941832 ] [ RRC reference ]

Beurton F, Stempor P, Caron M, Appert A, Dong Y, Chen RA, Cluet D, Couté Y, Herbette M, Huang N, Polveche H, Spichty M, Bedet C, Ahringer J, Palladino F.
Physical and functional interaction between SET1/COMPASS complex component CFP-1 and a Sin3S HDAC complex in C. elegans.
Nucleic Acids Res 2019 47(21) 11164-11180 
[ PubMed ID = 31602465 ] [ RRC reference ]