Mutants (Isolated)

tm635

Allele Nametm635
Sequence NameR07E4.6
CGC Namekin-2
Worm BaseAllele Name tm635
CGC Name kin-2
Sequence R07E4.6
Phenotypelethal or sterile
Mutation site28155/28156-28765/28766 (610 bp deletion )
ChromosomeX
Putative gene structurecomplement(join(27370..27542, 27906..28109, 28176..28290, 28335..28448, 28495..28608, 28673..28879, 33267..33349, 33409..33529))
Map position-3.98
BalancerNot Yet Balanced
Map position of balancer
Sequence of primersExtRev:GAGTTGAACATGTACCGGGT,IntRev:GTGAGCGAGTGGGTGTATTT,IntFwd:CCGATTAGGTCATCAGTTTG,ExtFwd:TGAGGAAGATGCGGGGCAAA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Lee JH, Han JS, Kong J, Ji Y, Lv X, Lee J, Li P, Kim JB.
Protein Kinase A Subunit Balance Regulates Lipid Metabolism in Caenorhabditis elegans and Mammalian Adipocytes.
J Biol Chem 2016 291(39) 20315-28 
[ PubMed ID = 27496951 ] [ RRC reference ]

Song BM, Avery L.
Serotonin activates overall feeding by activating two separate neural pathways in Caenorhabditis elegans.
J Neurosci 2012 32(6) 1920-31 
[ PubMed ID = 22323705 ] [ RRC reference ]