Mutants (Isolated)

tm631

Allele Nametm631
Sequence NameC04E12.7
CGC Namescrm-3
Worm BaseAllele Name tm631
CGC Name scrm-3
Sequence C04E12.7
Phenotypehomozygous viable
Mutation site3069/3070-3600/3601 (531 bp deletion)
ChromosomeV
Putative gene structurecomplement(join(2406..2490, 2548..2596, 2644..2746, 2887..3120, 3345..3674))
Map position-9.85
Balancer
Map position of balancer
Sequence of primersExtFwd:GAAGTTCACAGTCTCACGCA,IntFwd:CCGACTATGCTCTGCTACAT,IntRev:AACCGCTGCGACGGCAGAAA,ExtRev:CGACGAAATGAAAACGGCCA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Wang X, Wang J, Gengyo-Ando K, Gu L, Sun CL, Yang C, Shi Y, Kobayashi T, Shi Y, Mitani S, Xie XS, Xue D.
C. elegans mitochondrial factor WAH-1 promotes phosphatidylserine externalization in apoptotic cells through phospholipid scramblase SCRM-1.
Nat. Cell Biol. 2007 9(5) 541-9 
[ PubMed ID = 17401362 ] [ RRC reference ]