Mutants (Isolated)

tm629

Allele Nametm629
Sequence NameF46C3.1
CGC Namepek-1
Worm BaseAllele Name tm629
CGC Name pek-1
Sequence F46C3.1
Phenotypehomozygous viable. Dr. N. Tavernarakis: normal development, normal locomotion, slightly shorter, less progeny at 25C.
Mutation site1862/1863-TT-3335/3336 (1473 bp deletion + 2 bp insertion)
ChromosomeI
Putative gene structurejoin(complement(3682..3795), complement(3460..3624), complement(2750..3286), complement(2424..2700), complement(2206..2376), complement(1899..2155), complement(1748..1849), complement(1130..1425), complement(709..1079), complement(385..659), complement(105..304), complement(Z68104.1:26738..27119), complement(Z68104.1:26574..26660))
Map position-7.97
Balancer
Map position of balancer
Sequence of primersIntFwd:GAGGTTGAGTATGAGTCTCA,ExtFwd:TACCAGTCGTTGAACGGGCT,IntRev:GGCCAACAGTACATCGATGA,ExtRev:CTTGGTACCATTCAACGCTG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Nukazuka A, Fujisawa H, Inada T, Oda Y, Takagi S.
Semaphorin controls epidermal morphogenesis by stimulating mRNA translation via eIF2alpha in Caenorhabditis elegans.
Genes Dev. 2008 22(8) 1025-36 
[ PubMed ID = 18413715 ] [ RRC reference ]

Richardson CE, Kinkel S, Kim DH.
Physiological IRE-1-XBP-1 and PEK-1 signaling in Caenorhabditis elegans larval development and immunity.
PLoS Genet. 2011 7(11) e1002391 
[ PubMed ID = 22125500 ] [ RRC reference ]

Kulalert W, Kim DH.
The unfolded protein response in a pair of sensory neurons promotes entry of C. elegans into dauer diapause.
Curr. Biol. 2013 23(24) 2540-5 
[ PubMed ID = 24316205 ] [ RRC reference ]