Mutants (Isolated)

tm627

Allele Nametm627
Sequence NameF48E3.7
CGC Namelgc-11
Worm BaseAllele Name tm627
CGC Name lgc-11
Sequence F48E3.7
Phenotypehomozygous viable. Dr. J-L. Bessereau: sensitive to the nicotinic agonist DMPP.
Mutation site22969/22970-23415/23416 (446 bp deletion)
ChromosomeX
Putative gene structurecomplement(join(21164..21228, 21738..21891, 21969..22126, 22171..22267, 22533..22655, 22699..22806, 22849..22989, 23062..23140, 23200..23354, 23833..24033))
Map position-1.66
Balancer
Map position of balancer
Sequence of primersIntFwd:GTGAGACCCAATGACACCTT,ExtRev:CGATTATTCTTTGGCTGCGA,ExtFwd:GATAACAGCCATGGTAAGCA,IntRev:CCGTCTTTCACTAGAGCTTA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
White CV, Herman MA.
Transcriptomic, Functional, and Network Analyses Reveal Novel Genes Involved in the Interaction Between Caenorhabditis elegans and Stenotrophomonas maltophilia.
Front Cell Infect Microbiol 2018 8 266 
[ PubMed ID = 30177956 ] [ RRC reference ]