Mutants (Isolated)

tm6269

Allele Nametm6269
Sequence NameC17G1.8
CGC Nametsp-21
Worm BaseAllele Name tm6269
CGC Name tsp-21
Sequence C17G1.8
PhenotypeLet or Ste.
Mutation site14499/14500-14855/14856 (356 bp deletion)
ChromosomeX
Putative gene structurejoin(14500..14574, 14628..14715, 16114..16220, 16271..16339, 16427..16546, 17534..17701, 17747..17830, 17880..17947, 18038..18164)
Map position1.73
Balancer
Map position of balancer
Sequence of primersExtRev:CTAATCAATGGGGATTGCGT,IntFwd:TACTCCGCGCCGTTGTCTCA,IntRev:CCCTGCAACTTTCTCCGGGT,ExtFwd:GTAGCGCCGTACCGAAAATG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Liu Z, Shi H, Szymczak LC, Aydin T, Yun S, Constas K, Schaeffer A, Ranjan S, Kubba S, Alam E, McMahon DE, He J, Shwartz N, Tian C, Plavskin Y, Lindy A, Dad NA, Sheth S, Amin NM, Zimmerman S, Liu D, Schwarz EM, Smith H, Krause MW, Liu J.
Promotion of bone morphogenetic protein signaling by tetraspanins and glycosphingolipids.
PLoS Genet. 2015 11(5) e1005221 
[ PubMed ID = 25978409 ] [ RRC reference ]