Mutants (Isolated)

tm6254

Allele Nametm6254
Sequence NameY37E11AR.3
CGC Namenape-2
Worm BaseAllele Name tm6254
CGC Name nape-2
Sequence Y37E11AR.3
Phenotypehomozygous viable.
Mutation site1919/1920-TATTATTTTTTAGTACCGTTATTACATTATTT-2395/2396 (476 bp deletion + 32 bp insertion)
ChromosomeIV
Putative gene structurecomplement(join(222..338, 401..518, 566..925, 1717..2121, 2172..2245, 3038..3094))
Map position-2.55
Balancer
Map position of balancer
Sequence of primersIntRev:CAGTGCTAACGCTCGCCACT,ExtRev:ACGATGTAAACCCAAGCCTA,IntFwd:GGTGTCAGGCTGTCAGATTA,ExtFwd:TCGTAAAAGGACCCCAGCTG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Pastuhov SI, Matsumoto K, Hisamoto N.
Endocannabinoid signaling regulates regenerative axon navigation in Caenorhabditis elegans via the GPCRs NPR-19 and NPR-32.
Genes Cells 2016 21(7) 696-705 
[ PubMed ID = 27193416 ] [ RRC reference ]

Harrison N, Lone MA, Kaul TK, Reis Rodrigues P, Ogungbe IV, Gill MS.
Characterization of N-acyl phosphatidylethanolamine-specific phospholipase-D isoforms in the nematode Caenorhabditis elegans.
PLoS ONE 2014 9(11) e113007 
[ PubMed ID = 25423491 ] [ RRC reference ]