Mutants (Isolated)

tm6235

Allele Nametm6235
Sequence NameY49A10A.1
CGC Nameefhc-1
Worm BaseAllele Name tm6235
CGC Name efhc-1
Sequence Y49A10A.1
Phenotypehomozygous viable.
Mutation site6709/6710-7492/7493 (783 bp deletion)
ChromosomeX
Putative gene structurejoin(6061..6251, 6482..7019, 7063..7160, 7204..7313, 7360..7520, 7611..7682, 7732..7877, 7922..8042)
Map position1.98
Balancer
Map position of balancer
Sequence of primersExtFwd:TACCTTTCCATGTAACCCAC,IntFwd:TACCGCGTCGTTTCCGACGT,ExtRev:GACCGTACAATACAGAAGGA,IntRev:ACAGAAGGAGCATCAACCTA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Loucks CM, Park K, Walker DS, McEwan AH, Timbers TA, Ardiel EL, Grundy LJ, Li C, Johnson JL, Kennedy J, Blacque OE, Schafer W, Rankin CH, Leroux MR.
EFHC1, implicated in juvenile myoclonic epilepsy, functions at the cilium and synapse to modulate dopamine signaling.
Elife 2019 8  
[ PubMed ID = 30810526 ] [ RRC reference ]

Loucks CM, Bialas NJ, Dekkers MP, Walker DS, Grundy LJ, Li C, Inglis PN, Kida K, Schafer WR, Blacque OE, Jansen G, Leroux MR.
PACRG, a protein linked to ciliary motility, mediates cellular signaling.
Mol Biol Cell 2016 27(13) 2133-44 
[ PubMed ID = 27193298 ] [ RRC reference ]