Home > Mutants (Isolated) > tm6234

Mutants (Isolated)

Allele Name		tm6234
Allele Type		Normal
Sequence Name		F35D2.5
Gene Name		syd-1
Worm Base	Allele Name	tm6234
	Gene Name	syd-1
	Sequence	F35D2.5
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		24635/24636-25899/25900 (1264 bp deletion)
Chromosome		II
Putative gene structure		complement(join(22580..22662, 23204..23354, 23402..23757, 23825..24260, 24314..24792, 25087..25209, 25258..25525, 25677..25794, 25910..26064, 27634..27735, 27781..27859, 27902..28027, 28077..28226, 28271..28385, 28482..28524, 31067..31170, 31333..31408))
Map position		0.5
Balancer
Map position of balancer
Sequence of primers		ExtFwd:GCCCACGTCCTTCGACAATG,IntFwd:AACTGCTCACGCTTAAGCGA,ExtRev:CAGGGACCTTAGCAGCCGTT,IntRev:GTGCCCAAAACGACGCCGTT
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Nørgaard S, Deng S, Cao W, Pocock R. Distinct CED-10/Rac1 domains confer context-specific functions in development. PLoS Genet 2018 14(9) e1007670  [ PubMed ID = 30265669 ] [ RRC reference ] Xu Y, Taru H, Jin Y, Quinn CC. SYD-1C, UNC-40 (DCC) and SAX-3 (Robo) function interdependently to promote axon guidance by regulating the MIG-2 GTPase. PLoS Genet 2015 11(4) e1005185  [ PubMed ID = 25876065 ] [ RRC reference ] Edwards SL, Yorks RM, Morrison LM, Hoover CM, Miller KG. Synapse-Assembly Proteins Maintain Synaptic Vesicle Cluster Stability and Regulate Synaptic Vesicle Transport in Caenorhabditis elegans. Genetics 2015 201(1) 91-116  [ PubMed ID = 26354975 ] [ RRC reference ] Edwards SL, Morrison LM, Yorks RM, Hoover CM, Boominathan S, Miller KG. UNC-16 (JIP3) Acts Through Synapse-Assembly Proteins to Inhibit the Active Transport of Cell Soma Organelles to Caenorhabditis elegans Motor Neuron Axons. Genetics 2015 201(1) 117-41  [ PubMed ID = 26354976 ] [ RRC reference ]