Home > Mutants (Isolated) > tm6233

Mutants (Isolated)

Allele Name		tm6233
Allele Type		Balanced
Sequence Name		F10E7.8
Gene Name		farl-11
Worm Base	Allele Name	tm6233
	Gene Name	farl-11
	Sequence	F10E7.8
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		Let or Ste.
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		3478/3479-4060/4061 (582 bp deletion)
Chromosome		II
Putative gene structure		complement(join(900..1126, 1176..1637, 1685..1769, 1985..3460, 3510..3689, 3736..3885, 4119..4291, 4518..4554))
Map position		0.49
Balancer		mIn1 [e128 mIs14]
Map position of balancer
Sequence of primers		IntRev:CGTTAAAGCGGAGTGTCGTA,ExtRev:AGGCGCAAAATAACTACGGT,IntFwd:CGGTTTTCGTTTCTGGGATA,ExtFwd:CATAACCTTCACCAGAGCAC
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Martin SCT, Qadota H, Oberhauser AF, Hardin J, Benian GM. FARL-11 (STRIP1/2) is required for sarcomere and sarcoplasmic reticulum organization in C. elegans. Mol Biol Cell 2023 34(9) ar86  [ PubMed ID = 37314837 ] [ RRC reference ] Maheshwari R, Pushpa K, Subramaniam K. A role for post-transcriptional control of endoplasmic reticulum dynamics and function in C. elegans germline stem cell maintenance. Development 2016 143(17) 3097-108  [ PubMed ID = 27510976 ] [ RRC reference ]