Mutants (Isolated)

tm6221

Allele Nametm6221
Sequence NameT01D1.2
CGC Nameetr-1
Worm BaseAllele Name tm6221
CGC Name etr-1
Sequence T01D1.2
PhenotypeLet or Ste.
Mutation site4304/4305-4758/4759 (454 bp deletion)
ChromosomeII
Putative gene structurejoin(474..656, 1738..1975, 2033..2158, 3403..3482, 4085..4237, 4293..4410, 4506..4718, 5236..5379, 5881..6021, 6125..6355, 6884..7011)
Map position-15.9
Balancer
Map position of balancer
Sequence of primersIntFwd:CGATGGAGGTTCGCATATAG,ExtFwd:CGCCACCAAAGAAATGCATC,IntRev:CCGAATGCGTCATACTTAAC,ExtRev:ATGCATTACATCGGTGTGTC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Boateng R, Nguyen KCQ, Hall DH, Golden A, Allen AK.
Novel functions for the RNA-binding protein ETR-1 in Caenorhabditis elegans reproduction and engulfment of germline apoptotic cell corpses.
Dev Biol 2017 429(1) 306-320 
[ PubMed ID = 28648844 ] [ RRC reference ]