Mutants (Isolated)

tm6188

Allele Nametm6188
Sequence NameF49E10.5
CGC Namectbp-1
Worm BaseAllele Name tm6188
CGC Name ctbp-1
Sequence F49E10.5
Phenotypehomozygous viable.
Mutation site11515/11516-11915/11916 (400 bp deletion)
ChromosomeX
Putative gene structurejoin(3476..3634, 3888..3959, 4013..4121, 5274..5351, 10082..10159, 10219..10370, 11237..11381, 11428..11552, 11599..11789, 11844..12094, 12145..12242, 12685..12811, 12867..13465)
Map position-4.16
Balancer
Map position of balancer
Sequence of primersExtFwd:CATGCGCCTGGTGACTATGT,IntRev:GGCATCGTCCATTGATAGCT,IntFwd:AGACGTCGCCGATTCTACAC,ExtRev:AGTGGATGAGCTGAGCTAGT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Imae R, Dejima K, Kage-Nakadai E, Arai H, Mitani S.
Endomembrane-associated RSD-3 is important for RNAi induced by extracellular silencing RNA in both somatic and germ cells of Caenorhabditis elegans.
Sci Rep 2016 6 28198 
[ PubMed ID = 27306325 ] [ RRC reference ]