Mutants (Isolated)

tm618

Allele Nametm618
Sequence NameZK177.11
CGC NameZK177.11
Worm BaseAllele Name tm618
CGC Name ZK177.11
Sequence ZK177.11
Phenotypehomozygous viable. Dr. R. Lin, Dr. M. Maduro: normal cell division during 8-30 cell stage.
Mutation site21682/21683-TCAAAAATATATT-22958/22959 (1276 bp deletion + 13 bp insertion )
ChromosomeII
Putative gene structurejoin(21517..21653, 21738..21852)
Map position-1.21
Balancer
Map position of balancer
Sequence of primersExtRev:GTTTGAGGACCTCGGTCAGT,IntRev:GCCTCAACATCCATACAAGT,ExtFwd:GTGACTACGAACTCCACAAA,IntFwd:ATTCAAAACCGGATTGCCAC
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Broitman-Maduro G, Lin KT, Hung WW, Maduro MF.
Specification of the C. elegans MS blastomere by the T-box factor TBX-35.
Development 2006 133(16) 3097-106 
[ PubMed ID = 16831832 ] [ RRC reference ]