Mutants (Isolated)

tm6179

Allele Nametm6179
Sequence NameC54D2.4
CGC Namesul-3
Worm BaseAllele Name tm6179
CGC Name sul-3
Sequence C54D2.4
Phenotypehomozygous viable.
Mutation site8663/8664-9120/9121 (457 bp deletion)
ChromosomeX
Putative gene structurecomplement(join(3438..3567, 3613..3667, 4335..4420, 4477..4576, 4631..4698, 5708..5844, 5895..5992, 6212..6389, 7281..7390, 8475..8685, 8740..8791, 8854..8940, 10125..10279))
Map position-1.11
Balancer
Map position of balancer
Sequence of primersExtRev:CATTTCCTATGTAGCCGGAC,IntFwd:GGGGGTTGTGTGATAGGTGT,IntRev:TGTAGCCGGACCCAAAATTC,ExtFwd:GCATATCAGCAGGTGGGAAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Pérez-Jiménez MM, Monje-Moreno JM, Brokate-Llanos AM, Venegas-Calerón M, Sánchez-García A, Sansigre P, Valladares A, Esteban-García S, Suárez-Pereira I, Vitorica J, Ríos JJ, Artal-Sanz M, Carrión ÁM, Muñoz MJ.
Steroid hormones sulfatase inactivation extends lifespan and ameliorates age-related diseases.
Nat Commun 2021 12(1) 49 
[ PubMed ID = 33397961 ] [ RRC reference ]