Home > Mutants (Isolated) > tm617

Mutants (Isolated)

Allele Name		tm617
Allele Type		Normal
Sequence Name		R07B7.1
Gene Name		clh-6
Worm Base	Allele Name	tm617
	Gene Name	clh-6
	Sequence	R07B7.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		Homozygous viable. Dr. J. Satterlee: normal brood size, development and movement, quinine avoidance behavior. Dr. S. Shaham: no obvious defects in amphid function.
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		3812/3813-GTGTA-4375/4376 (563 bp deletion + 5 bp insertion)
Chromosome		V
Putative gene structure		complement(join(2098..2196, 2244..2427, 2535..2807, 2856..3291, 3337..4126, 4173..4366, 4413..4551, 4594..4740, 4788..4878, 4926..5005))
Map position		3.62
Balancer
Map position of balancer
Sequence of primers		ExtFwd:CGTCCATAATCAGGGAGTGA,IntRev:GGTCGTGGATTCCGTGCCTT,IntFwd:CGTATGGCGATTCTTCGATT,ExtRev:ATCAGGTTGTCAACTCTCGT
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Zhang Q, Li Y, Jian Y, Li M, Wang X. Lysosomal chloride transporter CLH-6 protects lysosome membrane integrity via cathepsin activation. J Cell Biol 2023 222(6)   [ PubMed ID = 37058288 ] [ RRC reference ] Park C, Sakurai Y, Sato H, Kanda S, Iino Y, Kunitomo H. Roles of the ClC chloride channel CLH-1 in food-associated salt chemotaxis behavior of C. elegans. Elife 2021 10   [ PubMed ID = 33492228 ] [ RRC reference ]