Home > Mutants (Isolated) > tm6151

Mutants (Isolated)

Allele Name		tm6151
Allele Type		Normal
Sequence Name		T02E1.5
Gene Name		dhs-3
Worm Base	Allele Name	tm6151
	Gene Name	dhs-3
	Sequence	T02E1.5
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		14390/14391-14935/14936 (545 bp deletion)
Chromosome		I
Putative gene structure		complement(join(8758..8854, 8908..9179, 9393..9488, 9534..9607, 10398..10515, 14347..14498, 14542..14656))
Map position		2.66
Balancer
Map position of balancer
Sequence of primers		IntRev:CCCATTCCTGTTAAATGCGA,ExtFwd:TGATACGGATACCATCCACA,IntFwd:CGCCGCTCTTGACACTAGCT,ExtRev:TGTACGGTACCGGGTCTCGA
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Radeke LJ, Herman MA. Identification and characterization of differentially expressed genes in Caenorhabditis elegans in response to pathogenic and nonpathogenic Stenotrophomonas maltophilia. BMC Microbiol 2020 20(1) 170  [ PubMed ID = 32560629 ] [ RRC reference ] Liu Y, Xu S, Zhang C, Zhu X, Hammad MA, Zhang X, Christian M, Zhang H, Liu P. Hydroxysteroid dehydrogenase family proteins on lipid droplets through bacteria, C. elegans, and mammals. Biochim Biophys Acta Mol Cell Biol Lipids 2018 1863(8) 881-894  [ PubMed ID = 29702244 ] [ RRC reference ]