Mutants (Isolated)

tm6145

Allele Nametm6145
Sequence NameF20A1.9
CGC Nametofu-2
Worm BaseAllele Name tm6145
CGC Name tofu-2
Sequence F20A1.9
Phenotypehomozygous viable.
Mutation site33062/33063-TTTTTTGTTTTGTGGG-33677/33678 (615 bp deletion + 16 bp insertion)
ChromosomeV
Putative gene structurecomplement(join(32433..32565, 32616..32740, 32787..32984, 33033..33129, 33172..33239, 33286..33734, 33791..34019, 34188..34190))
Map position0.5
Balancer
Map position of balancer
Sequence of primersExtFwd:CGTTGTGCGGCTGTTAGGAT,ExtRev:GGACTACACACACTCTCACT,IntFwd:GGCGGCGAAACTTGAATGAT,IntRev:TCGCATCAATTGCGGAGGAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Goh WS, Seah JW, Harrison EJ, Chen C, Hammell CM, Hannon GJ.
A genome-wide RNAi screen identifies factors required for distinct stages of C. elegans piRNA biogenesis.
Genes Dev. 2014 28(7) 797-807 
[ PubMed ID = 24696458 ] [ RRC reference ]

Kim KW, Tang NH, Andrusiak MG, Wu Z, Chisholm AD, Jin Y.
A Neuronal piRNA Pathway Inhibits Axon Regeneration in C. elegans.
Neuron 2018 97(3) 511-519.e6 
[ PubMed ID = 29395906 ] [ RRC reference ]