Home > Mutants (Isolated) > tm6139

Mutants (Isolated)

Allele Name		tm6139
Allele Type		Balanced
Sequence Name		T04D1.4
Gene Name		chd-7
Worm Base	Allele Name	tm6139
	Gene Name	chd-7
	Sequence	T04D1.4
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		Let or Ste.
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		25600/25601-26194/26195 (594 bp deletion)
Chromosome		I
Putative gene structure		complement(join(17151..17432, 17508..17773, 17951..19613, 19791..21724, 22308..23422, 24024..26092, 26140..26805, 27431..27943, 28256..28621))
Map position		-0.93
Balancer		hT2
Map position of balancer
Sequence of primers		ExtRev:GCTACTCGATAGAATACTCG,IntRev:CGGGTTCCCGTAATATGTGT,ExtFwd:GCTCCCATGTCACCTCTTCG,IntFwd:GTCCATCGTCTTCAGTAATG
Distributed lab
Depositor		Dr. S. Mitani
References		Please submit your publication Jofré DM, Hoffman DK, Cervino AS, Hahn GM, Grundy M, Yun S, Amrit FRG, Stolz DB, Godoy LF, Salvatore E, Rossi FA, Ghazi A, Cirio MC, Yanowitz JL, Hochbaum D. The CHARGE syndrome ortholog CHD-7 regulates TGF-β pathways in Caenorhabditis elegans. Proc Natl Acad Sci U S A 2022 119(15) e2109508119  [ PubMed ID = 35394881 ] [ RRC reference ] Wong WR, Brugman KI, Maher S, Oh JY, Howe K, Kato M, Sternberg PW. Autism-associated missense genetic variants impact locomotion and neurodevelopment in Caenorhabditis elegans. Hum Mol Genet 2019 28(13) 2271-2281  [ PubMed ID = 31220273 ] [ RRC reference ]