Mutants (Isolated)

tm6082

Allele Nametm6082
Sequence NameC43H8.2
CGC Namemafr-1
Worm BaseAllele Name tm6082
CGC Name mafr-1
Sequence C43H8.2
Phenotypehomozygous viable.
Mutation site4494/4495-4708/4709 (214 bp deletion)
ChromosomeI
Putative gene structurejoin(3902..3984, 4035..4374, 4424..4545, 4597..4789)
Map position5.06
Balancer
Map position of balancer
Sequence of primersExtFwd:TACACAGAAGTTGCCGACAG,IntFwd:TACGTAGGATTTTTCCGCAC,ExtRev:GCCGGCAAGACTAATACTAT,IntRev:ATGGACGTGTCGGCTTGTTT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Pradhan A, Hammerquist AM, Khanna A, Curran SP.
The C-Box Region of MAF1 Regulates Transcriptional Activity and Protein Stability.
J Mol Biol 2017 429(2) 192-207 
[ PubMed ID = 27986570 ] [ RRC reference ]

Cai Y, Wei YH.
Stress resistance and lifespan are increased in C. elegans but decreased in S. cerevisiae by mafr-1/maf1 deletion.
Oncotarget 2016 7(10) 10812-26 
[ PubMed ID = 26934328 ] [ RRC reference ]