Mutants (Isolated)

tm6077

Allele Nametm6077
Sequence NameF32D1.6
CGC Nameneg-1
Worm BaseAllele Name tm6077
CGC Name neg-1
Sequence F32D1.6
Phenotypelethal or sterile
Mutation site32366/32367-32773/32774 (407 bp deletion)
ChromosomeV
Putative gene structurecomplement(join(32427..32627, 32682..32789, 32840..32938, 33173..33259))
Map position-5.73
BalancernT1 [qIs51]
Map position of balancer
Sequence of primersIntFwd:TTCGCCGGAAACCAGAAAGC,ExtFwd:ATCTTGACACGACTGCGACT,IntRev:CAATGATTCCCGGCCGGCTT,ExtRev:ATCCCGGGAACTCCGAATCT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Elewa A, Shirayama M, Kaymak E, Harrison PF, Powell DR, Du Z, Chute CD, Woolf H, Yi D, Ishidate T, Srinivasan J, Bao Z, Beilharz TH, Ryder SP, Mello CC.
POS-1 Promotes Endo-mesoderm Development by Inhibiting the Cytoplasmic Polyadenylation of neg-1 mRNA.
Dev. Cell 2015 34(1) 108-18 
[ PubMed ID = 26096734 ] [ RRC reference ]