Mutants (Isolated)

tm607

Allele Nametm607
Sequence NameY40B1A.4
CGC Namesptf-3
Worm BaseAllele Name tm607
CGC Name sptf-3
Sequence Y40B1A.4
Phenotypelethal or sterile. Dr. M. Sundaram, Dr. R. Plasterk, Dr. WB. Derry, Dr. G. Jansen: zygotic embryonic lethal.
Mutation site17271/17272-17930/17931 (659 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(16824..16992, 17831..18067, 18662..18822, 18868..18965, 20263..20299))
Map position19.35
BalancerNot Yet Balanced
Map position of balancer
Sequence of primersIntRev:ACCATCTGCTCCAGCGAGAA,IntFwd:TCGATGACGTTGAAGTTCGT,ExtRev:ATGAAGGACCACCAGTTGCA,ExtFwd:CTCCAGTGTGGGTTCGTCGA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Hirose T, Horvitz HR.
An Sp1 transcription factor coordinates caspase-dependent and -independent apoptotic pathways.
Nature 2013 500(7462) 354-8 
[ PubMed ID = 23851392 ] [ RRC reference ]

Sun H, Nelms BL, Sleiman SF, Chamberlin HM, Hanna-Rose W.
Modulation of Caenorhabditis elegans transcription factor activity by HIM-8 and the related Zinc-Finger ZIM proteins.
Genetics 2007 177(2) 1221-6 
[ PubMed ID = 17720937 ] [ RRC reference ]