Mutants (Isolated)

tm604

Allele Nametm604
Sequence NameT05G5.2
CGC Namehlh-4
Worm BaseAllele Name tm604
CGC Name hlh-4
Sequence T05G5.2
Phenotypehomozygous viable.
Mutation site9219/9220-10003/10004 (784 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(8982..9536, 10270..10332))
Map position0.93
Balancer
Map position of balancer
Sequence of primersIntRev:TAAAATATCCGCCATGAGGG,ExtRev:CTTAAGCCGTACACTGTGCA,ExtFwd:TCCCGCCAGTGCTAAGGTTT,IntFwd:AACGATTGCTCTATGCACTG
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Dimitriadi M, Sleigh JN, Walker A, Chang HC, Sen A, Kalloo G, Harris J, Barsby T, Walsh MB, Satterlee JS, Li C, Van Vactor D, Artavanis-Tsakonas S, Hart AC.
Conserved genes act as modifiers of invertebrate SMN loss of function defects.
PLoS Genet. 2010 6(10) e1001172 
[ PubMed ID = 21124729 ] [ RRC reference ]

Masoudi N, Tavazoie S, Glenwinkel L, Ryu L, Kim K, Hobert O.
Unconventional function of an Achaete-Scute homolog as a terminal selector of nociceptive neuron identity.
PLoS Biol. 2018 16(4) e2004979 
[ PubMed ID = 29672507 ] [ RRC reference ]

Luo S, Horvitz HR.
The CDK8 Complex and Proneural Proteins Together Drive Neurogenesis from a Mesodermal Lineage.
Curr. Biol. 2017 27(5) 661-672 
[ PubMed ID = 28238659 ] [ RRC reference ]