Mutants (Isolated)

tm6034

Allele Nametm6034
Sequence NameC26F1.4
CGC Namerps-30
Worm BaseAllele Name tm6034
CGC Name rps-30
Sequence C26F1.4
PhenotypeLet or Ste.
Mutation site18928/18929-19216/19217 (288 bp deletion)
ChromosomeV
Putative gene structurejoin(18924..19004, 19084..19213, 19307..19488)
Map position0.89
BalancernT1
Map position of balancer
Sequence of primersExtRev:CTGGTATTTAGGAGTTGGAG,IntRev:GTTGGAGTTTGGTCCGCGCT,ExtFwd:ATCGAGGCAGTAGCGGCGAA,IntFwd:CGCGCTTTCGCTGCGTACTT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Yan B, Guo X, Zhou Q, Yang Y, Chen X, Sun W, Du A.
Hc-fau, a novel gene regulating diapause in the nematode parasite Haemonchus contortus.
Int. J. Parasitol. 2014 44(11) 775-86 
[ PubMed ID = 25058511 ] [ RRC reference ]