Home > Mutants (Isolated) > tm6026

Mutants (Isolated)

Allele Name		tm6026
Allele Type		Normal
Sequence Name		K02B2.3
Gene Name		mcu-1
Worm Base	Allele Name	tm6026
	Gene Name	mcu-1
	Sequence	K02B2.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		2082/2083-2409/2410 (327 bp deletion)
Chromosome		IV
Putative gene structure		complement(join(1390..1593, 1742..1860, 1910..2136, 2204..2336, 2382..2610, 2844..2933))
Map position		2.72
Balancer
Map position of balancer
Sequence of primers		IntRev:CGTCTTTTCAGGGTCACACA,ExtRev:TCCGTACAACACCACCACCA,IntFwd:CGTTCCCGAGCAGATGGATA,ExtFwd:TAGTGTAGACACGTTCCCGA
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Ryan KC, Ashkavand Z, Sarasija S, Laboy JT, Samarakoon R, Norman KR. Increased mitochondrial calcium uptake and concomitant mitochondrial activity by presenilin loss promotes mTORC1 signaling to drive neurodegeneration. Aging Cell 2021 20(10) e13472  [ PubMed ID = 34499406 ] [ RRC reference ] Ashkavand Z, Sarasija S, Ryan KC, Laboy JT, Norman KR. Corrupted ER-mitochondrial calcium homeostasis promotes the collapse of proteostasis. Aging Cell 2020 19(1) e13065  [ PubMed ID = 31714672 ] [ RRC reference ] Zhao T, Hao Y, Kaplan JM. Axonal Mitochondria Modulate Neuropeptide Secretion Through the Hypoxic Stress Response in Caenorhabditis elegans. Genetics 2018 210(1) 275-285  [ PubMed ID = 30049781 ] [ RRC reference ] Sarasija S, Laboy JT, Ashkavand Z, Bonner J, Tang Y, Norman KR. Presenilin mutations deregulate mitochondrial Ca2+ homeostasis and metabolic activity causing neurodegeneration in Caenorhabditis elegans. Elife 2018 7   [ PubMed ID = 29989545 ] [ RRC reference ]