Mutants (Isolated)

tm6026

Allele Nametm6026
Sequence NameK02B2.3
CGC Namemcu-1
Worm BaseAllele Name tm6026
CGC Name mcu-1
Sequence K02B2.3
Phenotypehomozygous viable.
Mutation site2082/2083-2409/2410 (327 bp deletion)
ChromosomeIV
Putative gene structurecomplement(join(1390..1593, 1742..1860, 1910..2136, 2204..2336, 2382..2610, 2844..2933))
Map position2.72
Balancer
Map position of balancer
Sequence of primersIntRev:CGTCTTTTCAGGGTCACACA,ExtRev:TCCGTACAACACCACCACCA,IntFwd:CGTTCCCGAGCAGATGGATA,ExtFwd:TAGTGTAGACACGTTCCCGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Sarasija S, Laboy JT, Ashkavand Z, Bonner J, Tang Y, Norman KR.
Presenilin mutations deregulate mitochondrial Ca2+ homeostasis and metabolic activity causing neurodegeneration in Caenorhabditis elegans.
Elife 2018 7  
[ PubMed ID = 29989545 ] [ RRC reference ]

Zhao T, Hao Y, Kaplan JM.
Axonal Mitochondria Modulate Neuropeptide Secretion Through the Hypoxic Stress Response in Caenorhabditis elegans.
Genetics 2018 210(1) 275-285 
[ PubMed ID = 30049781 ] [ RRC reference ]