Mutants (Isolated)

tm5996

Allele Nametm5996
Sequence NameC32E8.11
CGC Nameubr-1
Worm BaseAllele Name tm5996
CGC Name ubr-1
Sequence C32E8.11
Phenotypehomozygous viable.
Mutation site42839/42840-C-43280/43281 (441 bp deletion + 1 bp insertion)
ChromosomeI
Putative gene structurecomplement(join(34902..35145, 35658..35731, 35796..36386, 36440..36595, 36642..37112, 37666..38245, 38464..38634, 38683..38841, 38899..39672, 39721..39944, 40285..41046, 41096..41424, 41782..42423, 42483..42774, 42832..43134, 43341..43591, 43646..43726, FO080750.1:1401..1473))
Map position-2.37
Balancer
Map position of balancer
Sequence of primersExtRev:GTCCCAGAGGTGTTCGAAGT,IntRev:TGGGACAATACAGCCGCGAA,ExtFwd:ACTCCTGCCAACGCTGCTGT,IntFwd:CCGGCAACTAGACGTTGATC
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Weaver BP, Weaver YM, Mitani S, Han M.
Coupled Caspase and N-End Rule Ligase Activities Allow Recognition and Degradation of Pluripotency Factor LIN-28 during Non-Apoptotic Development.
Dev. Cell 2017 41(6) 665-673.e6 
[ PubMed ID = 28602583 ] [ RRC reference ]