Mutants (Isolated)

tm597

Allele Nametm597
Allele TypeBalanced
Sequence NameC09G12.8
Gene Nameced-10
Worm BaseAllele Name tm597
Gene Name ced-10
Sequence C09G12.8
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" lethal or sterile. Dr. M. Hengartner: engulfment defect., Dr. E. Lundquist: Genetics 172, 893-913 (2006).
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 34879/34880-35491/35492 (612 bp deletion)
ChromosomeIV
Putative gene structurecomplement(join(34079..34271, 34756..34941, 35209..35300, 36089..36193))
Map position-3.32
Balancer,tmC25[tmIs1241]
Map position of balancer
Sequence of primersExtFwd:GGGTGGATAAGTAAGAAAAGTAT,IntFwd:CGAGTTTAAGATGAAAAATCGTT,ExtRev:GTGTCGTCGTTGGTGACGGA,IntRev:GGTAAAACGTGTCTCCTGAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Venkatachalam T, Mannimala S, Pulijala Y, Soto MC.
CED-5/CED-12 (DOCK/ELMO) can promote and inhibit F-actin formation via distinct motifs that may target different GTPases.
PLoS Genet 2024 20(7) e1011330 
[ PubMed ID = 39083711 ] [ RRC reference ]

Venkatachalam T, Mannimala S, Soto MC.
CED-5/CED-12 (DOCK/ELMO) can promote and inhibit F-actin formation via distinct motifs that target different GTPases.
bioRxiv 2023   
[ PubMed ID = 37873140 ] [ RRC reference ]

Nørgaard S, Deng S, Cao W, Pocock R.
Distinct CED-10/Rac1 domains confer context-specific functions in development.
PLoS Genet 2018 14(9) e1007670 
[ PubMed ID = 30265669 ] [ RRC reference ]

Abdu Y, Maniscalco C, Heddleston JM, Chew TL, Nance J.
Developmentally programmed germ cell remodelling by endodermal cell cannibalism.
Nat Cell Biol 2016 18(12) 1302-1310 
[ PubMed ID = 27842058 ] [ RRC reference ]

Sasidharan S, Borinskaya S, Patel F, Bernadskaya Y, Mandalapu S, Agapito M, Soto MC.
WAVE regulates Cadherin junction assembly and turnover during epithelial polarization.
Dev Biol 2018 434(1) 133-148 
[ PubMed ID = 29223862 ] [ RRC reference ]

Borgen MA, Wang D, Grill B.
RPM-1 regulates axon termination by affecting growth cone collapse and microtubule stability.
Development 2017 144(24) 4658-4672 
[ PubMed ID = 29084805 ] [ RRC reference ]

Fleming T, Chien SC, Vanderzalm PJ, Dell M, Gavin MK, Forrester WC, Garriga G.
The role of C. elegans Ena/VASP homolog UNC-34 in neuronal polarity and motility.
Dev Biol 2010 344(1) 94-106 
[ PubMed ID = 20452341 ] [ RRC reference ]

Hsieh HH, Hsu TY, Jiang HS, Wu YC.
Integrin α PAT-2/CDC-42 signaling is required for muscle-mediated clearance of apoptotic cells in Caenorhabditis elegans.
PLoS Genet 2012 8(5) e1002663 
[ PubMed ID = 22615577 ] [ RRC reference ]

Demarco RS, Struckhoff EC, Lundquist EA.
The Rac GTP exchange factor TIAM-1 acts with CDC-42 and the guidance receptor UNC-40/DCC in neuronal protrusion and axon guidance.
PLoS Genet 2012 8(4) e1002665 
[ PubMed ID = 22570618 ] [ RRC reference ]

Patel FB, Soto MC.
WAVE/SCAR promotes endocytosis and early endosome morphology in polarized C. elegans epithelia.
Dev Biol 2013 377(2) 319-32 
[ PubMed ID = 23510716 ] [ RRC reference ]

Alan JK, Lundquist EA.
Analysis of Rho GTPase function in axon pathfinding using Caenorhabditis elegans.
Methods Mol Biol 2012 827 339-58 
[ PubMed ID = 22144285 ] [ RRC reference ]

Doi M, Minematsu H, Kubota Y, Nishiwaki K, Miyamoto M.
The novel Rac effector RIN-1 regulates neuronal cell migration and axon pathfinding in C. elegans.
Development 2013 140(16) 3435-44 
[ PubMed ID = 23900541 ] [ RRC reference ]

Walck-Shannon E, Reiner D, Hardin J.
Polarized Rac-dependent protrusions drive epithelial intercalation in the embryonic epidermis of C. elegans.
Development 2015 142(20) 3549-60 
[ PubMed ID = 26395474 ] [ RRC reference ]

Shakir MA, Jiang K, Struckhoff EC, Demarco RS, Patel FB, Soto MC, Lundquist EA.
The Arp2/3 activators WAVE and WASP have distinct genetic interactions with Rac GTPases in Caenorhabditis elegans axon guidance.
Genetics 2008 179(4) 1957-71 
[ PubMed ID = 18689885 ] [ RRC reference ]

Patel FB, Bernadskaya YY, Chen E, Jobanputra A, Pooladi Z, Freeman KL, Gally C, Mohler WA, Soto MC.
The WAVE/SCAR complex promotes polarized cell movements and actin enrichment in epithelia during C. elegans embryogenesis.
Dev Biol 2008 324(2) 297-309 
[ PubMed ID = 18938151 ] [ RRC reference ]

Shakir MA, Gill JS, Lundquist EA.
Interactions of UNC-34 Enabled with Rac GTPases and the NIK kinase MIG-15 in Caenorhabditis elegans axon pathfinding and neuronal migration.
Genetics 2006 172(2) 893-913 
[ PubMed ID = 16204220 ] [ RRC reference ]