Mutants (Isolated)

tm597

Allele Name

tm597

Sequence Name

C09G12.8

CGC Name

ced-10

Worm Base

Allele Name

tm597

CGC Name

ced-10

Sequence

C09G12.8

Phenotype

lethal or sterile. Dr. M. Hengartner: engulfment defect., Dr. E. Lundquist: Genetics 172, 893-913 (2006).

Mutation site

34879/34880-35491/35492 (612 bp deletion)

Chromosome

Putative gene structure

complement(join(34079..34271, 34756..34941, 35209..35300, 36089..36193))

Map position

-3.32

Balancer

Not Yet Balanced

Map position of balancer

Sequence of primers

ExtFwd:GGGTGGATAAGTAAGAAAAGTAT,IntFwd:CGAGTTTAAGATGAAAAATCGTT,ExtRev:GTGTCGTCGTTGGTGACGGA,IntRev:GGTAAAACGTGTCTCCTGAT

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Sasidharan S, Borinskaya S, Patel F, Bernadskaya Y, Mandalapu S, Agapito M, Soto MC.
WAVE regulates Cadherin junction assembly and turnover during epithelial polarization.
Dev Biol 2018 434(1) 133-148
[ PubMed ID = 29223862 ] [ RRC reference ]

Abdu Y, Maniscalco C, Heddleston JM, Chew TL, Nance J.
Developmentally programmed germ cell remodelling by endodermal cell cannibalism.
Nat Cell Biol 2016 18(12) 1302-1310
[ PubMed ID = 27842058 ] [ RRC reference ]

Fleming T, Chien SC, Vanderzalm PJ, Dell M, Gavin MK, Forrester WC, Garriga G.
The role of C. elegans Ena/VASP homolog UNC-34 in neuronal polarity and motility.
Dev Biol 2010 344(1) 94-106
[ PubMed ID = 20452341 ] [ RRC reference ]

Borgen MA, Wang D, Grill B.
RPM-1 regulates axon termination by affecting growth cone collapse and microtubule stability.
Development 2017 144(24) 4658-4672
[ PubMed ID = 29084805 ] [ RRC reference ]

Hsieh HH, Hsu TY, Jiang HS, Wu YC.
Integrin α PAT-2/CDC-42 signaling is required for muscle-mediated clearance of apoptotic cells in Caenorhabditis elegans.
PLoS Genet 2012 8(5) e1002663
[ PubMed ID = 22615577 ] [ RRC reference ]

Patel FB, Soto MC.
WAVE/SCAR promotes endocytosis and early endosome morphology in polarized C. elegans epithelia.
Dev Biol 2013 377(2) 319-32
[ PubMed ID = 23510716 ] [ RRC reference ]

Alan JK, Lundquist EA.
Analysis of Rho GTPase function in axon pathfinding using Caenorhabditis elegans.
Methods Mol Biol 2012 827 339-58
[ PubMed ID = 22144285 ] [ RRC reference ]

Doi M, Minematsu H, Kubota Y, Nishiwaki K, Miyamoto M.
The novel Rac effector RIN-1 regulates neuronal cell migration and axon pathfinding in C. elegans.
Development 2013 140(16) 3435-44
[ PubMed ID = 23900541 ] [ RRC reference ]

Walck-Shannon E, Reiner D, Hardin J.
Polarized Rac-dependent protrusions drive epithelial intercalation in the embryonic epidermis of C. elegans.
Development 2015 142(20) 3549-60
[ PubMed ID = 26395474 ] [ RRC reference ]

Demarco RS, Struckhoff EC, Lundquist EA.
The Rac GTP exchange factor TIAM-1 acts with CDC-42 and the guidance receptor UNC-40/DCC in neuronal protrusion and axon guidance.
PLoS Genet 2012 8(4) e1002665
[ PubMed ID = 22570618 ] [ RRC reference ]

Nørgaard S, Deng S, Cao W, Pocock R.
Distinct CED-10/Rac1 domains confer context-specific functions in development.
PLoS Genet 2018 14(9) e1007670
[ PubMed ID = 30265669 ] [ RRC reference ]

Shakir MA, Jiang K, Struckhoff EC, Demarco RS, Patel FB, Soto MC, Lundquist EA.
The Arp2/3 activators WAVE and WASP have distinct genetic interactions with Rac GTPases in Caenorhabditis elegans axon guidance.
Genetics 2008 179(4) 1957-71
[ PubMed ID = 18689885 ] [ RRC reference ]

Shakir MA, Gill JS, Lundquist EA.
Interactions of UNC-34 Enabled with Rac GTPases and the NIK kinase MIG-15 in Caenorhabditis elegans axon pathfinding and neuronal migration.
Genetics 2006 172(2) 893-913
[ PubMed ID = 16204220 ] [ RRC reference ]

Patel FB, Bernadskaya YY, Chen E, Jobanputra A, Pooladi Z, Freeman KL, Gally C, Mohler WA, Soto MC.
The WAVE/SCAR complex promotes polarized cell movements and actin enrichment in epithelia during C. elegans embryogenesis.
Dev Biol 2008 324(2) 297-309
[ PubMed ID = 18938151 ] [ RRC reference ]