Mutants (Isolated)

tm595

Allele Nametm595
Sequence NameF59D12.4
CGC Namegpn-1
Worm BaseAllele Name tm595
CGC Name gpn-1
Sequence F59D12.4
Phenotypehomozygous viable. Dr. M. Hengartner: no synthetic defects wid sdn-1 mutants.
Mutation site[C03H12] 137/138-[C03H12] 1548/1549 (1411 bp deletion)
ChromosomeX
Putative gene structurejoin(36275..36494, Z81459.1:105..286, Z81459.1:336..509, Z81459.1:1743..1905, Z81459.1:1949..2079, Z81459.1:3333..3479, Z81459.1:3601..3790, Z81459.1:3838..3980, Z81459.1:4192..4407)
Map position22.93
Balancer
Map position of balancer
Sequence of primersIntRev:GGAAACCAGATTTTGTCGGT,IntFwd:CGTTCACATGGATCTTGACT,ExtFwd:TCGAAAACCCTGCGAACCGT,ExtRev:GGAATTGGTTGTAGCGCGGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Blanchette CR, Perrat PN, Thackeray A, BĂ©nard CY.
Glypican Is a Modulator of Netrin-Mediated Axon Guidance.
PLoS Biol. 2015 13(7) e1002183 
[ PubMed ID = 26148345 ] [ RRC reference ]

Hudson ML, Kinnunen T, Cinar HN, Chisholm AD.
C. elegans Kallmann syndrome protein KAL-1 interacts with syndecan and glypican to regulate neuronal cell migrations.
Dev. Biol. 2006 294(2) 352-65 
[ PubMed ID = 16677626 ] [ RRC reference ]