Home > Mutants (Isolated) > tm595

Mutants (Isolated)

Allele Name		tm595
Allele Type		Normal
Sequence Name		F59D12.4
Gene Name		gpn-1
Worm Base	Allele Name	tm595
	Gene Name	gpn-1
	Sequence	F59D12.4
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable. Dr. M. Hengartner: no synthetic defects wid sdn-1 mutants.
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		[C03H12] 137/138-[C03H12] 1548/1549 (1411 bp deletion)
Chromosome		X
Putative gene structure		join(36275..36494, Z81459.1:105..286, Z81459.1:336..509, Z81459.1:1743..1905, Z81459.1:1949..2079, Z81459.1:3333..3479, Z81459.1:3601..3790, Z81459.1:3838..3980, Z81459.1:4192..4407)
Map position		22.93
Balancer
Map position of balancer
Sequence of primers		IntRev:GGAAACCAGATTTTGTCGGT,IntFwd:CGTTCACATGGATCTTGACT,ExtFwd:TCGAAAACCCTGCGAACCGT,ExtRev:GGAATTGGTTGTAGCGCGGA
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Blanchette CR, Perrat PN, Thackeray A, Bénard CY. Glypican Is a Modulator of Netrin-Mediated Axon Guidance. PLoS Biol 2015 13(7) e1002183  [ PubMed ID = 26148345 ] [ RRC reference ] Hudson ML, Kinnunen T, Cinar HN, Chisholm AD. C. elegans Kallmann syndrome protein KAL-1 interacts with syndecan and glypican to regulate neuronal cell migrations. Dev Biol 2006 294(2) 352-65  [ PubMed ID = 16677626 ] [ RRC reference ]