Mutants (Isolated)

tm5916

Allele Nametm5916
Sequence NameC04F5.3
CGC Nameunc-46
Worm BaseAllele Name tm5916
CGC Name unc-46
Sequence C04F5.3
Phenotypehomozygous viable.
Mutation site9329/9330-9604/9605 (275 bp deletion)
ChromosomeV
Putative gene structurecomplement(join(7985..8175, 8663..8727, 8773..8887, 8946..9021, 9072..9197, 9267..9341, 9393..9524))
Map position-2.51
Balancer
Map position of balancer
Sequence of primersExtRev:TGGGTCGTAGAATGGAATAC,IntFwd:ATCCCTCTTTCCTTCCCCGA,IntRev:CTGGTCCTCCAATCCGTGCT,ExtFwd:TGCCTGCATAAATCCACTTC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Deng L, Denham JE, Arya C, Yuval O, Cohen N, Haspel G.
Inhibition Underlies Fast Undulatory Locomotion in Caenorhabditis elegans.
eNeuro 2021 8(2)  
[ PubMed ID = 33361147 ] [ RRC reference ]