Mutants (Isolated)

tm5913

Allele Nametm5913
Sequence NameF59G1.7
CGC Namefrh-1
Worm BaseAllele Name tm5913
CGC Name frh-1
Sequence F59G1.7
Phenotypelethal or sterile
Mutation site21291/21292-21642/21643 (351 bp deletion)
ChromosomeII
Putative gene structurejoin(21324..21534, 21581..21677, 21929..22031)
Map position-0.85
Balancer
Map position of balancer
Sequence of primersIntFwd:CGGTCTCGACGACACATCAT,ExtFwd:TACCCGGTCTCGACGACACA,IntRev:CCGGATTAGACATGTCGCGA,ExtRev:TCGTGAATCTGAATCCGTCA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Ast T, Meisel JD, Patra S, Wang H, Grange RMH, Kim SH, Calvo SE, Orefice LL, Nagashima F, Ichinose F, Zapol WM, Ruvkun G, Barondeau DP, Mootha VK.
Hypoxia Rescues Frataxin Loss by Restoring Iron Sulfur Cluster Biogenesis.
Cell 2019 177(6) 1507-1521.e16 
[ PubMed ID = 31031004 ] [ RRC reference ]