Mutants (Isolated)

tm5866

Allele Nametm5866
Sequence NameY64G10A.6
CGC NameY64G10A.6
Worm BaseAllele Name tm5866
CGC Name Y64G10A.6
Sequence Y64G10A.6
Phenotypehomozygous viable.
Mutation site48565/48566-TGTTTTG-49127/49128 (562 bp deletion + 7 bp insertion)
ChromosomeIV
Putative gene structurejoin(45574..45889, 47119..47396, 48214..48400, 48456..48577, 48818..49070, 49126..49216, 49300..49475, 49843..49949, 52009..52217, 52609..53314, 54093..54188)
Map position11.69
Balancer
Map position of balancer
Sequence of primersIntRev:TCCCTGTATCTCCTACTCAC,ExtRev:GATTGCGTAGGTGTGCCTGA,IntFwd:CTTATAAAACCGCAGGCCTT,ExtFwd:CATGTTCTGCCAGTGCCATA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Chen C, Itakura E, Nelson GM, Sheng M, Laurent P, Fenk LA, Butcher RA, Hegde RS, de Bono M.
IL-17 is a neuromodulator of Caenorhabditis elegans sensory responses.
Nature 2017 542(7639) 43-48 
[ PubMed ID = 28099418 ] [ RRC reference ]